| Variant ID: vg0826973911 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 26973911 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTGTTAAAAATAATCCTCGAATAGTCTCAAGTATCACTTTAACTTTCTGATTGGTGTTCATAGTTTTGTTCACATTTGTTTTCGCTAACCTTGGATACAG[T/A]
AGATGGTATATATATTTGATTTCCATCTTTAATCCCAAAACTTGTGGATTACGGGCTTTACTAAAACTTGTGCGTGTGTGTGCATATTGCCTTTTCAACC
GGTTGAAAAGGCAATATGCACACACACGCACAAGTTTTAGTAAAGCCCGTAATCCACAAGTTTTGGGATTAAAGATGGAAATCAAATATATATACCATCT[A/T]
CTGTATCCAAGGTTAGCGAAAACAAATGTGAACAAAACTATGAACACCAATCAGAAAGTTAAAGTGATACTTGAGACTATTCGAGGATTATTTTTAACAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.30% | 24.10% | 0.36% | 37.26% | NA |
| All Indica | 2759 | 7.80% | 39.30% | 0.47% | 52.48% | NA |
| All Japonica | 1512 | 96.60% | 2.20% | 0.00% | 1.19% | NA |
| Aus | 269 | 7.80% | 0.00% | 1.49% | 90.71% | NA |
| Indica I | 595 | 3.00% | 56.50% | 0.34% | 40.17% | NA |
| Indica II | 465 | 24.70% | 46.70% | 0.43% | 28.17% | NA |
| Indica III | 913 | 2.70% | 26.90% | 0.33% | 69.99% | NA |
| Indica Intermediate | 786 | 7.30% | 36.10% | 0.76% | 55.85% | NA |
| Temperate Japonica | 767 | 96.30% | 2.90% | 0.00% | 0.78% | NA |
| Tropical Japonica | 504 | 97.60% | 1.00% | 0.00% | 1.39% | NA |
| Japonica Intermediate | 241 | 95.40% | 2.50% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 79.20% | 1.00% | 0.00% | 19.79% | NA |
| Intermediate | 90 | 38.90% | 25.60% | 0.00% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0826973911 | T -> A | LOC_Os08g42670.1 | intron_variant ; MODIFIER | silent_mutation | Average:26.147; most accessible tissue: Zhenshan97 young leaf, score: 52.657 | N | N | N | N |
| vg0826973911 | T -> A | LOC_Os08g42670.2 | intron_variant ; MODIFIER | silent_mutation | Average:26.147; most accessible tissue: Zhenshan97 young leaf, score: 52.657 | N | N | N | N |
| vg0826973911 | T -> DEL | N | N | silent_mutation | Average:26.147; most accessible tissue: Zhenshan97 young leaf, score: 52.657 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0826973911 | NA | 1.33E-06 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826973911 | NA | 4.53E-11 | mr1352 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826973911 | NA | 6.93E-06 | mr1740 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826973911 | NA | 9.52E-10 | mr1881 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826973911 | NA | 2.24E-23 | mr1943 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826973911 | NA | 8.70E-06 | mr1943 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826973911 | NA | 4.64E-06 | mr1956 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |