\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0826947091:

Variant ID: vg0826947091 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 26947091
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGATGGGATTGCGGAAGGGAGAACAAGCACGATAGGGAAGAAGGAGCCTATCCTCTGACTTAACTGCTGTGCAGTTCAGTCACTGACATGTGGGCCATAG[C/T]
AAAGTGGGACCCACATGTCAGTGACTCAACTGCATGTGCAGTTAAGTCAGAGGATCTGCTTCCCCTCGATCCATGTCCCCAGAGCTCGGTCCCGCCGCCA

Reverse complement sequence

TGGCGGCGGGACCGAGCTCTGGGGACATGGATCGAGGGGAAGCAGATCCTCTGACTTAACTGCACATGCAGTTGAGTCACTGACATGTGGGTCCCACTTT[G/A]
CTATGGCCCACATGTCAGTGACTGAACTGCACAGCAGTTAAGTCAGAGGATAGGCTCCTTCTTCCCTATCGTGCTTGTTCTCCCTTCCGCAATCCCATCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.30% 8.20% 4.34% 15.21% NA
All Indica  2759 71.10% 9.60% 4.60% 14.68% NA
All Japonica  1512 79.20% 3.80% 3.37% 13.56% NA
Aus  269 36.80% 20.10% 7.43% 35.69% NA
Indica I  595 76.60% 4.20% 7.56% 11.60% NA
Indica II  465 82.60% 10.30% 0.43% 6.67% NA
Indica III  913 65.20% 11.40% 4.60% 18.84% NA
Indica Intermediate  786 66.90% 11.30% 4.83% 16.92% NA
Temperate Japonica  767 94.70% 1.30% 0.91% 3.13% NA
Tropical Japonica  504 62.70% 6.90% 6.55% 23.81% NA
Japonica Intermediate  241 64.70% 5.40% 4.56% 25.31% NA
VI/Aromatic  96 92.70% 1.00% 3.12% 3.12% NA
Intermediate  90 76.70% 7.80% 4.44% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0826947091 C -> T LOC_Os08g42620.1 upstream_gene_variant ; 4922.0bp to feature; MODIFIER silent_mutation Average:83.95; most accessible tissue: Zhenshan97 panicle, score: 94.811 N N N N
vg0826947091 C -> T LOC_Os08g42640.1 upstream_gene_variant ; 1481.0bp to feature; MODIFIER silent_mutation Average:83.95; most accessible tissue: Zhenshan97 panicle, score: 94.811 N N N N
vg0826947091 C -> T LOC_Os08g42620.2 upstream_gene_variant ; 4922.0bp to feature; MODIFIER silent_mutation Average:83.95; most accessible tissue: Zhenshan97 panicle, score: 94.811 N N N N
vg0826947091 C -> T LOC_Os08g42630.1 downstream_gene_variant ; 416.0bp to feature; MODIFIER silent_mutation Average:83.95; most accessible tissue: Zhenshan97 panicle, score: 94.811 N N N N
vg0826947091 C -> T LOC_Os08g42630-LOC_Os08g42640 intergenic_region ; MODIFIER silent_mutation Average:83.95; most accessible tissue: Zhenshan97 panicle, score: 94.811 N N N N
vg0826947091 C -> DEL N N silent_mutation Average:83.95; most accessible tissue: Zhenshan97 panicle, score: 94.811 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0826947091 C T 0.0 -0.01 0.0 0.0 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0826947091 NA 3.17E-06 mr1554 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826947091 2.58E-06 2.58E-06 mr1601 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826947091 NA 2.20E-06 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826947091 NA 4.78E-10 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826947091 NA 9.02E-07 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826947091 NA 8.07E-06 mr1723_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826947091 NA 2.92E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826947091 NA 4.03E-06 mr1771_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826947091 NA 2.32E-08 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251