\
| Variant ID: vg0826936491 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 26936491 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GAAGGGAGAGAGGGAGGAGGAAGGTCTGTCAGTGGGCCCACATTTCTTTTTGTGTGAATGACTAATGGGTCCCACGCATATTTTTTATTTCTACCGCCAC[G/A]
TAGGTGCCACGTCATCGCCACGTGGAACGAAGACTCGGTCAATATTGCCACGTAGGCGCCACGTGGCACCACGTCAGCAAAACCACCTCCCAAAACCGCC
GGCGGTTTTGGGAGGTGGTTTTGCTGACGTGGTGCCACGTGGCGCCTACGTGGCAATATTGACCGAGTCTTCGTTCCACGTGGCGATGACGTGGCACCTA[C/T]
GTGGCGGTAGAAATAAAAAATATGCGTGGGACCCATTAGTCATTCACACAAAAAGAAATGTGGGCCCACTGACAGACCTTCCTCCTCCCTCTCTCCCTTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.20% | 5.80% | 0.06% | 2.90% | NA |
| All Indica | 2759 | 86.70% | 8.40% | 0.11% | 4.86% | NA |
| All Japonica | 1512 | 99.70% | 0.10% | 0.00% | 0.20% | NA |
| Aus | 269 | 86.60% | 13.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 76.80% | 12.90% | 0.00% | 10.25% | NA |
| Indica II | 465 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 84.30% | 9.30% | 0.22% | 6.13% | NA |
| Indica Intermediate | 786 | 90.60% | 7.10% | 0.13% | 2.16% | NA |
| Temperate Japonica | 767 | 99.50% | 0.30% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0826936491 | G -> A | LOC_Os08g42610.1 | upstream_gene_variant ; 1232.0bp to feature; MODIFIER | silent_mutation | Average:47.179; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg0826936491 | G -> A | LOC_Os08g42620.1 | downstream_gene_variant ; 2285.0bp to feature; MODIFIER | silent_mutation | Average:47.179; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg0826936491 | G -> A | LOC_Os08g42620.2 | downstream_gene_variant ; 2285.0bp to feature; MODIFIER | silent_mutation | Average:47.179; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg0826936491 | G -> A | LOC_Os08g42610-LOC_Os08g42620 | intergenic_region ; MODIFIER | silent_mutation | Average:47.179; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg0826936491 | G -> DEL | N | N | silent_mutation | Average:47.179; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0826936491 | 2.89E-08 | 2.93E-08 | mr1120 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826936491 | NA | 7.78E-06 | mr1705 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |