\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0826935517:

Variant ID: vg0826935517 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 26935517
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGAATAAGATCACCTTGACTCCCTCAACTTACCACCGAATCTAAATCGTATCCCTCAACCGCAATACCAGAAATCACTCCCCAAACTTACAAAACCGGTG[T/C]
AATTTGACTCACTGGGCGGTTTTGGGAGACGGTTTTACTGACGTGGCGCCTACGTGGCAATATTGACCGAGTCTTCGTTCCATGTGGCGATGACGTGGCA

Reverse complement sequence

TGCCACGTCATCGCCACATGGAACGAAGACTCGGTCAATATTGCCACGTAGGCGCCACGTCAGTAAAACCGTCTCCCAAAACCGCCCAGTGAGTCAAATT[A/G]
CACCGGTTTTGTAAGTTTGGGGAGTGATTTCTGGTATTGCGGTTGAGGGATACGATTTAGATTCGGTGGTAAGTTGAGGGAGTCAAGGTGATCTTATTCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.30% 42.60% 0.68% 3.41% NA
All Indica  2759 77.60% 16.10% 0.62% 5.73% NA
All Japonica  1512 3.00% 96.40% 0.40% 0.20% NA
Aus  269 97.40% 1.10% 1.49% 0.00% NA
Indica I  595 75.10% 13.30% 0.50% 11.09% NA
Indica II  465 87.70% 11.80% 0.22% 0.22% NA
Indica III  913 77.20% 15.00% 0.55% 7.23% NA
Indica Intermediate  786 73.80% 22.00% 1.02% 3.18% NA
Temperate Japonica  767 3.10% 96.50% 0.13% 0.26% NA
Tropical Japonica  504 2.00% 97.00% 0.79% 0.20% NA
Japonica Intermediate  241 5.00% 94.60% 0.41% 0.00% NA
VI/Aromatic  96 21.90% 78.10% 0.00% 0.00% NA
Intermediate  90 54.40% 40.00% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0826935517 T -> C LOC_Os08g42610.1 upstream_gene_variant ; 258.0bp to feature; MODIFIER silent_mutation Average:95.11; most accessible tissue: Callus, score: 99.071 N N N N
vg0826935517 T -> C LOC_Os08g42620.1 downstream_gene_variant ; 3259.0bp to feature; MODIFIER silent_mutation Average:95.11; most accessible tissue: Callus, score: 99.071 N N N N
vg0826935517 T -> C LOC_Os08g42620.2 downstream_gene_variant ; 3259.0bp to feature; MODIFIER silent_mutation Average:95.11; most accessible tissue: Callus, score: 99.071 N N N N
vg0826935517 T -> C LOC_Os08g42610-LOC_Os08g42620 intergenic_region ; MODIFIER silent_mutation Average:95.11; most accessible tissue: Callus, score: 99.071 N N N N
vg0826935517 T -> DEL N N silent_mutation Average:95.11; most accessible tissue: Callus, score: 99.071 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0826935517 T C -0.07 -0.08 -0.07 -0.06 -0.06 -0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0826935517 NA 2.76E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826935517 NA 5.92E-06 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826935517 NA 9.57E-06 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826935517 NA 7.60E-06 mr1045_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826935517 NA 7.96E-08 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826935517 NA 9.00E-06 mr1137_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826935517 NA 4.79E-12 mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826935517 NA 7.81E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826935517 NA 5.69E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826935517 NA 3.63E-06 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826935517 NA 1.69E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826935517 NA 2.65E-06 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826935517 NA 1.59E-08 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826935517 NA 2.23E-07 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826935517 NA 5.58E-06 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826935517 NA 4.11E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826935517 NA 2.04E-06 mr1617_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826935517 NA 6.36E-06 mr1696_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826935517 NA 1.86E-06 mr1771_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826935517 NA 1.74E-12 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826935517 NA 3.54E-07 mr1830_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826935517 NA 6.04E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826935517 NA 8.25E-06 mr1924_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826935517 NA 9.51E-06 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826935517 NA 4.74E-06 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826935517 NA 1.03E-10 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251