\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0826648729:

Variant ID: vg0826648729 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 26648729
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGATATGTGGGACCCGCATGTCAGTAGGGCCCACAATTATTTTTGTATGAATGACAAATGGGCCCCGCATATATTTTTTTAATTTTAATGCCACATAAGC[G/A]
CCACGTCAATGCTACGTGGGACGAAGACCAAGTCAACACTGCCATGTGTGCGCCACGTCAACAAAACCACTCTCCAAAATCACTAAGGGAGCCAAATTGT

Reverse complement sequence

ACAATTTGGCTCCCTTAGTGATTTTGGAGAGTGGTTTTGTTGACGTGGCGCACACATGGCAGTGTTGACTTGGTCTTCGTCCCACGTAGCATTGACGTGG[C/T]
GCTTATGTGGCATTAAAATTAAAAAAATATATGCGGGGCCCATTTGTCATTCATACAAAAATAATTGTGGGCCCTACTGACATGCGGGTCCCACATATCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.00% 10.70% 0.85% 22.45% NA
All Indica  2759 58.20% 14.50% 1.20% 26.17% NA
All Japonica  1512 87.20% 0.10% 0.07% 12.63% NA
Aus  269 16.40% 38.30% 1.49% 43.87% NA
Indica I  595 49.60% 24.00% 2.18% 24.20% NA
Indica II  465 88.60% 1.30% 0.22% 9.89% NA
Indica III  913 40.40% 17.20% 1.64% 40.74% NA
Indica Intermediate  786 67.30% 11.80% 0.51% 20.36% NA
Temperate Japonica  767 96.00% 0.00% 0.00% 4.04% NA
Tropical Japonica  504 81.20% 0.00% 0.20% 18.65% NA
Japonica Intermediate  241 71.80% 0.80% 0.00% 27.39% NA
VI/Aromatic  96 94.80% 0.00% 0.00% 5.21% NA
Intermediate  90 68.90% 1.10% 2.22% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0826648729 G -> A LOC_Os08g42160.1 upstream_gene_variant ; 2983.0bp to feature; MODIFIER silent_mutation Average:43.579; most accessible tissue: Minghui63 root, score: 91.333 N N N N
vg0826648729 G -> A LOC_Os08g42180.1 upstream_gene_variant ; 203.0bp to feature; MODIFIER silent_mutation Average:43.579; most accessible tissue: Minghui63 root, score: 91.333 N N N N
vg0826648729 G -> A LOC_Os08g42189.2 upstream_gene_variant ; 3385.0bp to feature; MODIFIER silent_mutation Average:43.579; most accessible tissue: Minghui63 root, score: 91.333 N N N N
vg0826648729 G -> A LOC_Os08g42189.3 upstream_gene_variant ; 3385.0bp to feature; MODIFIER silent_mutation Average:43.579; most accessible tissue: Minghui63 root, score: 91.333 N N N N
vg0826648729 G -> A LOC_Os08g42170.1 downstream_gene_variant ; 1475.0bp to feature; MODIFIER silent_mutation Average:43.579; most accessible tissue: Minghui63 root, score: 91.333 N N N N
vg0826648729 G -> A LOC_Os08g42180-LOC_Os08g42189 intergenic_region ; MODIFIER silent_mutation Average:43.579; most accessible tissue: Minghui63 root, score: 91.333 N N N N
vg0826648729 G -> DEL N N silent_mutation Average:43.579; most accessible tissue: Minghui63 root, score: 91.333 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0826648729 G A -0.01 -0.01 -0.01 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0826648729 NA 2.62E-06 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826648729 NA 6.40E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826648729 NA 3.33E-06 mr1641 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826648729 NA 1.45E-07 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826648729 NA 2.68E-06 mr1735 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826648729 NA 1.07E-07 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826648729 NA 2.81E-08 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826648729 NA 2.84E-08 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826648729 NA 7.99E-06 mr1031_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826648729 NA 8.06E-06 mr1494_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826648729 NA 4.24E-06 mr1579_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826648729 NA 1.73E-06 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826648729 NA 1.03E-06 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826648729 NA 1.74E-06 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826648729 NA 2.02E-09 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826648729 NA 5.32E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826648729 NA 2.41E-06 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826648729 NA 4.77E-06 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826648729 NA 6.91E-06 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826648729 3.44E-06 3.45E-06 mr1985_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826648729 NA 4.47E-06 mr1985_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251