\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0826647284:

Variant ID: vg0826647284 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 26647284
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


CCATTTCTTCAATTCCTGCGCCCATGTATGTATGCTTAATTTGGCTTGTTTAATTAACTGTATGTACACATGCTGCATGCATGTTCGATTTCTATCACCC[C/T]
ATTCATTAATCGTGGCCGAAACAGTTCATGTCCACTAATGATTGCTGTATCTATCTACATATATCAAACCGTGAATAAAAGTTGTTATAAAACGTACTGT

Reverse complement sequence

ACAGTACGTTTTATAACAACTTTTATTCACGGTTTGATATATGTAGATAGATACAGCAATCATTAGTGGACATGAACTGTTTCGGCCACGATTAATGAAT[G/A]
GGGTGATAGAAATCGAACATGCATGCAGCATGTGTACATACAGTTAATTAAACAAGCCAAATTAAGCATACATACATGGGCGCAGGAATTGAAGAAATGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.90% 25.70% 1.78% 24.59% NA
All Indica  2759 24.80% 43.30% 2.68% 29.18% NA
All Japonica  1512 86.00% 0.30% 0.26% 13.43% NA
Aus  269 51.70% 1.50% 1.12% 45.72% NA
Indica I  595 29.90% 39.70% 0.50% 29.92% NA
Indica II  465 7.50% 79.40% 2.15% 10.97% NA
Indica III  913 29.90% 21.20% 4.82% 44.03% NA
Indica Intermediate  786 25.30% 50.40% 2.16% 22.14% NA
Temperate Japonica  767 95.30% 0.10% 0.26% 4.30% NA
Tropical Japonica  504 79.60% 0.40% 0.40% 19.64% NA
Japonica Intermediate  241 70.10% 0.40% 0.00% 29.46% NA
VI/Aromatic  96 95.80% 0.00% 0.00% 4.17% NA
Intermediate  90 54.40% 12.20% 3.33% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0826647284 C -> T LOC_Os08g42160.1 upstream_gene_variant ; 1538.0bp to feature; MODIFIER silent_mutation Average:16.487; most accessible tissue: Minghui63 root, score: 70.332 N N N N
vg0826647284 C -> T LOC_Os08g42189.2 upstream_gene_variant ; 4830.0bp to feature; MODIFIER silent_mutation Average:16.487; most accessible tissue: Minghui63 root, score: 70.332 N N N N
vg0826647284 C -> T LOC_Os08g42189.3 upstream_gene_variant ; 4830.0bp to feature; MODIFIER silent_mutation Average:16.487; most accessible tissue: Minghui63 root, score: 70.332 N N N N
vg0826647284 C -> T LOC_Os08g42170.1 downstream_gene_variant ; 30.0bp to feature; MODIFIER silent_mutation Average:16.487; most accessible tissue: Minghui63 root, score: 70.332 N N N N
vg0826647284 C -> T LOC_Os08g42180.1 downstream_gene_variant ; 559.0bp to feature; MODIFIER silent_mutation Average:16.487; most accessible tissue: Minghui63 root, score: 70.332 N N N N
vg0826647284 C -> T LOC_Os08g42170-LOC_Os08g42180 intergenic_region ; MODIFIER silent_mutation Average:16.487; most accessible tissue: Minghui63 root, score: 70.332 N N N N
vg0826647284 C -> DEL N N silent_mutation Average:16.487; most accessible tissue: Minghui63 root, score: 70.332 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0826647284 NA 6.84E-07 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647284 NA 1.90E-06 mr1219 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647284 NA 9.28E-08 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647284 NA 8.15E-06 mr1543 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647284 NA 3.49E-07 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647284 NA 1.66E-06 mr1919 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647284 NA 9.00E-06 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647284 NA 1.92E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647284 NA 7.47E-06 mr1186_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647284 NA 4.30E-06 mr1186_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647284 NA 2.97E-06 mr1245_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647284 NA 3.46E-07 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647284 NA 6.07E-07 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647284 NA 2.56E-08 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647284 NA 2.06E-06 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647284 NA 3.89E-06 mr1373_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647284 NA 5.95E-06 mr1373_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647284 NA 1.54E-06 mr1397_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647284 NA 9.40E-07 mr1445_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647284 NA 3.00E-09 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647284 NA 2.27E-06 mr1508_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647284 NA 7.29E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647284 NA 3.49E-21 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647284 NA 9.03E-06 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647284 NA 6.96E-06 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647284 NA 2.03E-06 mr1669_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647284 1.00E-06 1.00E-06 mr1674_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647284 NA 8.31E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647284 NA 4.80E-06 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647284 NA 3.87E-09 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647284 NA 5.23E-11 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647284 3.58E-06 2.25E-06 mr1851_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647284 NA 6.05E-06 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647284 NA 2.16E-06 mr1977_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251