Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0826637282:

Variant ID: vg0826637282 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 26637282
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTCTAATCCTCTTGATATCCTAGCAGGTGTGGAACGAACGGAACTCTAGATTTTTCGACTACTCACTCTTTTCAATTTTGGTGGTATTGGAGTTCATCCG[T/C]
TTGGAAGGTCGTCTCTAGTCTTTTGTCGGCGCTGCTGTTTTTGGAGTATTTCTAGGATTTTAGTGGGCTCCACCACCACCTTCCCTCACATTAGGAGTCT

Reverse complement sequence

AGACTCCTAATGTGAGGGAAGGTGGTGGTGGAGCCCACTAAAATCCTAGAAATACTCCAAAAACAGCAGCGCCGACAAAAGACTAGAGACGACCTTCCAA[A/G]
CGGATGAACTCCAATACCACCAAAATTGAAAAGAGTGAGTAGTCGAAAAATCTAGAGTTCCGTTCGTTCCACACCTGCTAGGATATCAAGAGGATTAGAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.90%	7.40%	3.24%	23.49%	NA
All Indica	2759	58.00%	12.50%	2.50%	26.97%	NA
All Japonica	1512	87.30%	0.10%	0.33%	12.24%	NA
Aus	269	15.60%	0.00%	28.25%	56.13%	NA
Indica I	595	48.90%	23.70%	1.34%	26.05%	NA
Indica II	465	88.60%	1.10%	0.65%	9.68%	NA
Indica III	913	40.30%	13.90%	4.16%	41.62%	NA
Indica Intermediate	786	67.30%	9.30%	2.54%	20.87%	NA
Temperate Japonica	767	95.70%	0.00%	0.13%	4.17%	NA
Tropical Japonica	504	81.50%	0.00%	0.60%	17.86%	NA
Japonica Intermediate	241	72.60%	0.80%	0.41%	26.14%	NA
VI/Aromatic	96	94.80%	0.00%	0.00%	5.21%	NA
Intermediate	90	68.90%	0.00%	3.33%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0826637282	T -> C	LOC_Os08g42150.1	upstream_gene_variant ; 3191.0bp to feature; MODIFIER	silent_mutation	Average:26.653; most accessible tissue: Minghui63 root, score: 68.826	N	N	N	N
vg0826637282	T -> C	LOC_Os08g42160.1	downstream_gene_variant ; 4481.0bp to feature; MODIFIER	silent_mutation	Average:26.653; most accessible tissue: Minghui63 root, score: 68.826	N	N	N	N
vg0826637282	T -> C	LOC_Os08g42140-LOC_Os08g42150	intergenic_region ; MODIFIER	silent_mutation	Average:26.653; most accessible tissue: Minghui63 root, score: 68.826	N	N	N	N
vg0826637282	T -> DEL	N	N	silent_mutation	Average:26.653; most accessible tissue: Minghui63 root, score: 68.826	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0826637282	NA	3.97E-07	mr1070	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282	NA	7.97E-06	mr1128	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282	NA	4.54E-07	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282	6.12E-07	6.12E-07	mr1249	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282	NA	9.14E-06	mr1327	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282	NA	2.48E-06	mr1627	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282	NA	3.07E-06	mr1641	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282	NA	3.91E-07	mr1692	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282	NA	6.57E-07	mr1735	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282	NA	3.04E-06	mr1735	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282	NA	4.08E-11	mr1739	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282	NA	8.85E-08	mr1739	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282	NA	1.90E-06	mr1759	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282	NA	5.41E-09	mr1839	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282	NA	5.45E-06	mr1909	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282	NA	9.85E-06	mr1959	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282	8.44E-07	4.01E-07	mr1985	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282	6.12E-07	6.12E-07	mr1985	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282	NA	3.40E-06	mr1015_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282	NA	2.93E-06	mr1031_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282	NA	5.73E-06	mr1641_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282	NA	2.96E-06	mr1683_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282	NA	7.35E-06	mr1759_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282	NA	9.34E-06	mr1759_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251