\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0826637282:

Variant ID: vg0826637282 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 26637282
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCTAATCCTCTTGATATCCTAGCAGGTGTGGAACGAACGGAACTCTAGATTTTTCGACTACTCACTCTTTTCAATTTTGGTGGTATTGGAGTTCATCCG[T/C]
TTGGAAGGTCGTCTCTAGTCTTTTGTCGGCGCTGCTGTTTTTGGAGTATTTCTAGGATTTTAGTGGGCTCCACCACCACCTTCCCTCACATTAGGAGTCT

Reverse complement sequence

AGACTCCTAATGTGAGGGAAGGTGGTGGTGGAGCCCACTAAAATCCTAGAAATACTCCAAAAACAGCAGCGCCGACAAAAGACTAGAGACGACCTTCCAA[A/G]
CGGATGAACTCCAATACCACCAAAATTGAAAAGAGTGAGTAGTCGAAAAATCTAGAGTTCCGTTCGTTCCACACCTGCTAGGATATCAAGAGGATTAGAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.90% 7.40% 3.24% 23.49% NA
All Indica  2759 58.00% 12.50% 2.50% 26.97% NA
All Japonica  1512 87.30% 0.10% 0.33% 12.24% NA
Aus  269 15.60% 0.00% 28.25% 56.13% NA
Indica I  595 48.90% 23.70% 1.34% 26.05% NA
Indica II  465 88.60% 1.10% 0.65% 9.68% NA
Indica III  913 40.30% 13.90% 4.16% 41.62% NA
Indica Intermediate  786 67.30% 9.30% 2.54% 20.87% NA
Temperate Japonica  767 95.70% 0.00% 0.13% 4.17% NA
Tropical Japonica  504 81.50% 0.00% 0.60% 17.86% NA
Japonica Intermediate  241 72.60% 0.80% 0.41% 26.14% NA
VI/Aromatic  96 94.80% 0.00% 0.00% 5.21% NA
Intermediate  90 68.90% 0.00% 3.33% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0826637282 T -> C LOC_Os08g42150.1 upstream_gene_variant ; 3191.0bp to feature; MODIFIER silent_mutation Average:26.653; most accessible tissue: Minghui63 root, score: 68.826 N N N N
vg0826637282 T -> C LOC_Os08g42160.1 downstream_gene_variant ; 4481.0bp to feature; MODIFIER silent_mutation Average:26.653; most accessible tissue: Minghui63 root, score: 68.826 N N N N
vg0826637282 T -> C LOC_Os08g42140-LOC_Os08g42150 intergenic_region ; MODIFIER silent_mutation Average:26.653; most accessible tissue: Minghui63 root, score: 68.826 N N N N
vg0826637282 T -> DEL N N silent_mutation Average:26.653; most accessible tissue: Minghui63 root, score: 68.826 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0826637282 NA 3.97E-07 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282 NA 7.97E-06 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282 NA 4.54E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282 6.12E-07 6.12E-07 mr1249 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282 NA 9.14E-06 mr1327 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282 NA 2.48E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282 NA 3.07E-06 mr1641 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282 NA 3.91E-07 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282 NA 6.57E-07 mr1735 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282 NA 3.04E-06 mr1735 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282 NA 4.08E-11 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282 NA 8.85E-08 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282 NA 1.90E-06 mr1759 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282 NA 5.41E-09 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282 NA 5.45E-06 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282 NA 9.85E-06 mr1959 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282 8.44E-07 4.01E-07 mr1985 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282 6.12E-07 6.12E-07 mr1985 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282 NA 3.40E-06 mr1015_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282 NA 2.93E-06 mr1031_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282 NA 5.73E-06 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282 NA 2.96E-06 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282 NA 7.35E-06 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826637282 NA 9.34E-06 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251