\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0826636852:

Variant ID: vg0826636852 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 26636852
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCACTTCAGGTTCAGAGGACCATTTTGTCTGGCGTTGGACGAGTGACCAACGATACTCGACAGGCTTGGCTTGCCATGCGTTATTTCTCGGCCAACAAT[C/T]
CTTTGCTTGCGCCAATCTTCTTTGGCAAGCTAAAAGTCCCGTTAAGTGCAAATTATTCCTGTGGCTTGCGTTCCAGCAACATTGTTGGACGGCCGACCTT

Reverse complement sequence

AAGGTCGGCCGTCCAACAATGTTGCTGGAACGCAAGCCACAGGAATAATTTGCACTTAACGGGACTTTTAGCTTGCCAAAGAAGATTGGCGCAAGCAAAG[G/A]
ATTGTTGGCCGAGAAATAACGCATGGCAAGCCAAGCCTGTCGAGTATCGTTGGTCACTCGTCCAACGCCAGACAAAATGGTCCTCTGAACCTGAAGTGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.40% 6.20% 1.74% 22.66% NA
All Indica  2759 59.90% 10.50% 2.68% 26.82% NA
All Japonica  1512 87.40% 0.10% 0.40% 12.10% NA
Aus  269 55.80% 0.00% 0.37% 43.87% NA
Indica I  595 48.90% 21.20% 3.53% 26.39% NA
Indica II  465 89.20% 0.40% 0.43% 9.89% NA
Indica III  913 44.10% 11.20% 3.83% 40.85% NA
Indica Intermediate  786 69.30% 7.80% 2.04% 20.87% NA
Temperate Japonica  767 95.80% 0.00% 0.13% 4.04% NA
Tropical Japonica  504 81.70% 0.00% 0.79% 17.46% NA
Japonica Intermediate  241 72.20% 0.80% 0.41% 26.56% NA
VI/Aromatic  96 94.80% 0.00% 0.00% 5.21% NA
Intermediate  90 71.10% 0.00% 1.11% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0826636852 C -> T LOC_Os08g42140.1 upstream_gene_variant ; 4773.0bp to feature; MODIFIER silent_mutation Average:26.248; most accessible tissue: Minghui63 root, score: 72.551 N N N N
vg0826636852 C -> T LOC_Os08g42150.1 upstream_gene_variant ; 3621.0bp to feature; MODIFIER silent_mutation Average:26.248; most accessible tissue: Minghui63 root, score: 72.551 N N N N
vg0826636852 C -> T LOC_Os08g42160.1 downstream_gene_variant ; 4911.0bp to feature; MODIFIER silent_mutation Average:26.248; most accessible tissue: Minghui63 root, score: 72.551 N N N N
vg0826636852 C -> T LOC_Os08g42140-LOC_Os08g42150 intergenic_region ; MODIFIER silent_mutation Average:26.248; most accessible tissue: Minghui63 root, score: 72.551 N N N N
vg0826636852 C -> DEL N N silent_mutation Average:26.248; most accessible tissue: Minghui63 root, score: 72.551 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0826636852 NA 3.14E-07 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852 NA 1.01E-06 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852 4.25E-06 4.24E-06 mr1249 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852 NA 8.27E-06 mr1327 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852 NA 5.95E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852 NA 4.33E-06 mr1641 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852 NA 3.04E-07 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852 NA 8.19E-07 mr1735 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852 NA 3.88E-06 mr1735 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852 NA 5.56E-11 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852 NA 1.12E-07 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852 NA 7.05E-07 mr1759 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852 NA 8.72E-06 mr1759 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852 NA 3.11E-08 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852 NA 8.97E-06 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852 NA 6.39E-06 mr1959 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852 2.62E-07 1.76E-07 mr1985 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852 2.43E-07 2.42E-07 mr1985 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852 NA 2.42E-06 mr1031_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852 NA 6.18E-06 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852 NA 1.88E-06 mr1579_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852 NA 8.32E-07 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852 NA 7.33E-06 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852 NA 9.56E-06 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852 6.51E-06 6.51E-06 mr1833_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251