Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0826636852:

Variant ID: vg0826636852 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 26636852
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTCACTTCAGGTTCAGAGGACCATTTTGTCTGGCGTTGGACGAGTGACCAACGATACTCGACAGGCTTGGCTTGCCATGCGTTATTTCTCGGCCAACAAT[C/T]
CTTTGCTTGCGCCAATCTTCTTTGGCAAGCTAAAAGTCCCGTTAAGTGCAAATTATTCCTGTGGCTTGCGTTCCAGCAACATTGTTGGACGGCCGACCTT

Reverse complement sequence

AAGGTCGGCCGTCCAACAATGTTGCTGGAACGCAAGCCACAGGAATAATTTGCACTTAACGGGACTTTTAGCTTGCCAAAGAAGATTGGCGCAAGCAAAG[G/A]
ATTGTTGGCCGAGAAATAACGCATGGCAAGCCAAGCCTGTCGAGTATCGTTGGTCACTCGTCCAACGCCAGACAAAATGGTCCTCTGAACCTGAAGTGAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.40%	6.20%	1.74%	22.66%	NA
All Indica	2759	59.90%	10.50%	2.68%	26.82%	NA
All Japonica	1512	87.40%	0.10%	0.40%	12.10%	NA
Aus	269	55.80%	0.00%	0.37%	43.87%	NA
Indica I	595	48.90%	21.20%	3.53%	26.39%	NA
Indica II	465	89.20%	0.40%	0.43%	9.89%	NA
Indica III	913	44.10%	11.20%	3.83%	40.85%	NA
Indica Intermediate	786	69.30%	7.80%	2.04%	20.87%	NA
Temperate Japonica	767	95.80%	0.00%	0.13%	4.04%	NA
Tropical Japonica	504	81.70%	0.00%	0.79%	17.46%	NA
Japonica Intermediate	241	72.20%	0.80%	0.41%	26.56%	NA
VI/Aromatic	96	94.80%	0.00%	0.00%	5.21%	NA
Intermediate	90	71.10%	0.00%	1.11%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0826636852	C -> T	LOC_Os08g42140.1	upstream_gene_variant ; 4773.0bp to feature; MODIFIER	silent_mutation	Average:26.248; most accessible tissue: Minghui63 root, score: 72.551	N	N	N	N
vg0826636852	C -> T	LOC_Os08g42150.1	upstream_gene_variant ; 3621.0bp to feature; MODIFIER	silent_mutation	Average:26.248; most accessible tissue: Minghui63 root, score: 72.551	N	N	N	N
vg0826636852	C -> T	LOC_Os08g42160.1	downstream_gene_variant ; 4911.0bp to feature; MODIFIER	silent_mutation	Average:26.248; most accessible tissue: Minghui63 root, score: 72.551	N	N	N	N
vg0826636852	C -> T	LOC_Os08g42140-LOC_Os08g42150	intergenic_region ; MODIFIER	silent_mutation	Average:26.248; most accessible tissue: Minghui63 root, score: 72.551	N	N	N	N
vg0826636852	C -> DEL	N	N	silent_mutation	Average:26.248; most accessible tissue: Minghui63 root, score: 72.551	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0826636852	NA	3.14E-07	mr1070	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852	NA	1.01E-06	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852	4.25E-06	4.24E-06	mr1249	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852	NA	8.27E-06	mr1327	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852	NA	5.95E-06	mr1627	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852	NA	4.33E-06	mr1641	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852	NA	3.04E-07	mr1692	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852	NA	8.19E-07	mr1735	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852	NA	3.88E-06	mr1735	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852	NA	5.56E-11	mr1739	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852	NA	1.12E-07	mr1739	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852	NA	7.05E-07	mr1759	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852	NA	8.72E-06	mr1759	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852	NA	3.11E-08	mr1839	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852	NA	8.97E-06	mr1909	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852	NA	6.39E-06	mr1959	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852	2.62E-07	1.76E-07	mr1985	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852	2.43E-07	2.42E-07	mr1985	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852	NA	2.42E-06	mr1031_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852	NA	6.18E-06	mr1336_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852	NA	1.88E-06	mr1579_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852	NA	8.32E-07	mr1683_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852	NA	7.33E-06	mr1759_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852	NA	9.56E-06	mr1759_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636852	6.51E-06	6.51E-06	mr1833_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251