Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0826636843:

Variant ID: vg0826636843 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 26636843
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCTCTTCAACTCACTTCAGGTTCAGAGGACCATTTTGTCTGGCGTTGGACGAGTGACCAACGATACTCGACAGGCTTGGCTTGCCATGCGTTATTTCTCG[G/T]
CCAACAATCCTTTGCTTGCGCCAATCTTCTTTGGCAAGCTAAAAGTCCCGTTAAGTGCAAATTATTCCTGTGGCTTGCGTTCCAGCAACATTGTTGGACG

Reverse complement sequence

CGTCCAACAATGTTGCTGGAACGCAAGCCACAGGAATAATTTGCACTTAACGGGACTTTTAGCTTGCCAAAGAAGATTGGCGCAAGCAAAGGATTGTTGG[C/A]
CGAGAAATAACGCATGGCAAGCCAAGCCTGTCGAGTATCGTTGGTCACTCGTCCAACGCCAGACAAAATGGTCCTCTGAACCTGAAGTGAGTTGAAGAGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.30%	8.20%	3.24%	22.28%	NA
All Indica	2759	58.60%	10.00%	5.15%	26.24%	NA
All Japonica	1512	87.40%	0.00%	0.53%	12.10%	NA
Aus	269	16.00%	39.80%	0.74%	43.49%	NA
Indica I	595	49.70%	14.30%	10.59%	25.38%	NA
Indica II	465	88.80%	0.60%	0.86%	9.68%	NA
Indica III	913	41.20%	13.90%	4.49%	40.42%	NA
Indica Intermediate	786	67.60%	7.90%	4.33%	20.23%	NA
Temperate Japonica	767	96.00%	0.00%	0.26%	3.78%	NA
Tropical Japonica	504	81.50%	0.00%	0.60%	17.86%	NA
Japonica Intermediate	241	72.20%	0.00%	1.24%	26.56%	NA
VI/Aromatic	96	94.80%	0.00%	0.00%	5.21%	NA
Intermediate	90	70.00%	2.20%	1.11%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0826636843	G -> T	LOC_Os08g42140.1	upstream_gene_variant ; 4764.0bp to feature; MODIFIER	silent_mutation	Average:26.961; most accessible tissue: Minghui63 root, score: 75.485	N	N	N	N
vg0826636843	G -> T	LOC_Os08g42150.1	upstream_gene_variant ; 3630.0bp to feature; MODIFIER	silent_mutation	Average:26.961; most accessible tissue: Minghui63 root, score: 75.485	N	N	N	N
vg0826636843	G -> T	LOC_Os08g42160.1	downstream_gene_variant ; 4920.0bp to feature; MODIFIER	silent_mutation	Average:26.961; most accessible tissue: Minghui63 root, score: 75.485	N	N	N	N
vg0826636843	G -> T	LOC_Os08g42140-LOC_Os08g42150	intergenic_region ; MODIFIER	silent_mutation	Average:26.961; most accessible tissue: Minghui63 root, score: 75.485	N	N	N	N
vg0826636843	G -> DEL	N	N	silent_mutation	Average:26.961; most accessible tissue: Minghui63 root, score: 75.485	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0826636843	NA	3.14E-07	mr1070	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843	NA	1.01E-06	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843	3.76E-06	NA	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843	4.25E-06	4.24E-06	mr1249	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843	NA	5.95E-06	mr1627	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843	NA	4.33E-06	mr1641	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843	NA	3.04E-07	mr1692	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843	NA	3.88E-06	mr1735	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843	NA	3.41E-07	mr1739	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843	NA	1.12E-07	mr1739	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843	NA	8.72E-06	mr1759	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843	NA	3.11E-08	mr1839	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843	NA	8.97E-06	mr1909	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843	NA	6.39E-06	mr1959	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843	2.43E-07	2.42E-07	mr1985	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843	NA	2.42E-06	mr1031_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843	NA	6.18E-06	mr1336_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843	NA	1.88E-06	mr1579_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843	NA	8.32E-07	mr1683_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843	NA	3.71E-06	mr1759_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843	NA	9.56E-06	mr1759_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843	6.51E-06	6.51E-06	mr1833_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843	8.00E-06	8.01E-06	mr1985_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251