\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0826636843:

Variant ID: vg0826636843 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 26636843
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTCTTCAACTCACTTCAGGTTCAGAGGACCATTTTGTCTGGCGTTGGACGAGTGACCAACGATACTCGACAGGCTTGGCTTGCCATGCGTTATTTCTCG[G/T]
CCAACAATCCTTTGCTTGCGCCAATCTTCTTTGGCAAGCTAAAAGTCCCGTTAAGTGCAAATTATTCCTGTGGCTTGCGTTCCAGCAACATTGTTGGACG

Reverse complement sequence

CGTCCAACAATGTTGCTGGAACGCAAGCCACAGGAATAATTTGCACTTAACGGGACTTTTAGCTTGCCAAAGAAGATTGGCGCAAGCAAAGGATTGTTGG[C/A]
CGAGAAATAACGCATGGCAAGCCAAGCCTGTCGAGTATCGTTGGTCACTCGTCCAACGCCAGACAAAATGGTCCTCTGAACCTGAAGTGAGTTGAAGAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.30% 8.20% 3.24% 22.28% NA
All Indica  2759 58.60% 10.00% 5.15% 26.24% NA
All Japonica  1512 87.40% 0.00% 0.53% 12.10% NA
Aus  269 16.00% 39.80% 0.74% 43.49% NA
Indica I  595 49.70% 14.30% 10.59% 25.38% NA
Indica II  465 88.80% 0.60% 0.86% 9.68% NA
Indica III  913 41.20% 13.90% 4.49% 40.42% NA
Indica Intermediate  786 67.60% 7.90% 4.33% 20.23% NA
Temperate Japonica  767 96.00% 0.00% 0.26% 3.78% NA
Tropical Japonica  504 81.50% 0.00% 0.60% 17.86% NA
Japonica Intermediate  241 72.20% 0.00% 1.24% 26.56% NA
VI/Aromatic  96 94.80% 0.00% 0.00% 5.21% NA
Intermediate  90 70.00% 2.20% 1.11% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0826636843 G -> T LOC_Os08g42140.1 upstream_gene_variant ; 4764.0bp to feature; MODIFIER silent_mutation Average:26.961; most accessible tissue: Minghui63 root, score: 75.485 N N N N
vg0826636843 G -> T LOC_Os08g42150.1 upstream_gene_variant ; 3630.0bp to feature; MODIFIER silent_mutation Average:26.961; most accessible tissue: Minghui63 root, score: 75.485 N N N N
vg0826636843 G -> T LOC_Os08g42160.1 downstream_gene_variant ; 4920.0bp to feature; MODIFIER silent_mutation Average:26.961; most accessible tissue: Minghui63 root, score: 75.485 N N N N
vg0826636843 G -> T LOC_Os08g42140-LOC_Os08g42150 intergenic_region ; MODIFIER silent_mutation Average:26.961; most accessible tissue: Minghui63 root, score: 75.485 N N N N
vg0826636843 G -> DEL N N silent_mutation Average:26.961; most accessible tissue: Minghui63 root, score: 75.485 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0826636843 NA 3.14E-07 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843 NA 1.01E-06 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843 3.76E-06 NA mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843 4.25E-06 4.24E-06 mr1249 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843 NA 5.95E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843 NA 4.33E-06 mr1641 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843 NA 3.04E-07 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843 NA 3.88E-06 mr1735 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843 NA 3.41E-07 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843 NA 1.12E-07 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843 NA 8.72E-06 mr1759 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843 NA 3.11E-08 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843 NA 8.97E-06 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843 NA 6.39E-06 mr1959 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843 2.43E-07 2.42E-07 mr1985 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843 NA 2.42E-06 mr1031_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843 NA 6.18E-06 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843 NA 1.88E-06 mr1579_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843 NA 8.32E-07 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843 NA 3.71E-06 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843 NA 9.56E-06 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843 6.51E-06 6.51E-06 mr1833_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826636843 8.00E-06 8.01E-06 mr1985_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251