\
| Variant ID: vg0826635155 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 26635155 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AGACGAAATGTCAAACATTTGTCAAAAAGTCAACGGCGTCATACATTAAAATATGGAGGTAGTATCATCTTGTAGTTTGTATCATCCTAATAAATACAAT[A/G]
CATGCATCCAATAGAATTAGAGAACATGAGAGTGGAGGATTTAAAAAAGTAATAATTTCATGGAGAATGGGCCATAGTTATATTATGGAATATAAAAAAA
TTTTTTTATATTCCATAATATAACTATGGCCCATTCTCCATGAAATTATTACTTTTTTAAATCCTCCACTCTCATGTTCTCTAATTCTATTGGATGCATG[T/C]
ATTGTATTTATTAGGATGATACAAACTACAAGATGATACTACCTCCATATTTTAATGTATGACGCCGTTGACTTTTTGACAAATGTTTGACATTTCGTCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.20% | 0.30% | 11.05% | 23.44% | NA |
| All Indica | 2759 | 58.70% | 0.30% | 13.59% | 27.44% | NA |
| All Japonica | 1512 | 83.80% | 0.00% | 2.91% | 13.29% | NA |
| Aus | 269 | 14.90% | 3.30% | 36.06% | 45.72% | NA |
| Indica I | 595 | 49.90% | 0.00% | 21.85% | 28.24% | NA |
| Indica II | 465 | 89.00% | 0.20% | 0.86% | 9.89% | NA |
| Indica III | 913 | 40.60% | 0.40% | 17.52% | 41.40% | NA |
| Indica Intermediate | 786 | 68.40% | 0.30% | 10.31% | 20.99% | NA |
| Temperate Japonica | 767 | 95.20% | 0.00% | 0.26% | 4.56% | NA |
| Tropical Japonica | 504 | 75.20% | 0.00% | 4.96% | 19.84% | NA |
| Japonica Intermediate | 241 | 65.60% | 0.00% | 7.05% | 27.39% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 0.00% | 5.21% | NA |
| Intermediate | 90 | 68.90% | 0.00% | 6.67% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0826635155 | A -> G | LOC_Os08g42140.1 | upstream_gene_variant ; 3076.0bp to feature; MODIFIER | silent_mutation | Average:18.129; most accessible tissue: Minghui63 root, score: 50.524 | N | N | N | N |
| vg0826635155 | A -> G | LOC_Os08g42140-LOC_Os08g42150 | intergenic_region ; MODIFIER | silent_mutation | Average:18.129; most accessible tissue: Minghui63 root, score: 50.524 | N | N | N | N |
| vg0826635155 | A -> DEL | N | N | silent_mutation | Average:18.129; most accessible tissue: Minghui63 root, score: 50.524 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0826635155 | NA | 9.41E-07 | mr1070 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826635155 | NA | 6.55E-07 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826635155 | 6.11E-07 | NA | mr1249 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826635155 | 1.34E-06 | 1.34E-06 | mr1249 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826635155 | NA | 1.93E-06 | mr1692 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826635155 | NA | 2.23E-08 | mr1739 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826635155 | NA | 4.69E-08 | mr1739 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826635155 | NA | 1.35E-07 | mr1839 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826635155 | NA | 3.33E-06 | mr1959 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826635155 | 9.42E-07 | 9.42E-07 | mr1985 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826635155 | NA | 3.33E-06 | mr1263_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826635155 | NA | 5.08E-06 | mr1336_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826635155 | NA | 2.14E-06 | mr1579_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826635155 | NA | 6.30E-06 | mr1729_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826635155 | NA | 6.33E-06 | mr1759_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |