\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0826601883:

Variant ID: vg0826601883 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 26601883
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGCCGCGTAGAAACGTTTGTCTTTTTGTGCTGTTTTATTTGTTTTTTACTCCCTCCGTCCTATAATATAAGGGATTTTGAGTTTTTGTTTGCAACGTTT[T/G]
ACCACTTGTCTTATTCAAATTTTTAAAATTATTATTTATTTTATTTATGACTTACTTTATTATCTGCAGTACTTTAAGCATAACTTTTCATTTTTTATAT

Reverse complement sequence

ATATAAAAAATGAAAAGTTATGCTTAAAGTACTGCAGATAATAAAGTAAGTCATAAATAAAATAAATAATAATTTTAAAAATTTGAATAAGACAAGTGGT[A/C]
AAACGTTGCAAACAAAAACTCAAAATCCCTTATATTATAGGACGGAGGGAGTAAAAAACAAATAAAACAGCACAAAAAGACAAACGTTTCTACGCGGCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.80% 31.80% 0.49% 0.00% NA
All Indica  2759 99.10% 0.60% 0.33% 0.00% NA
All Japonica  1512 10.30% 89.00% 0.66% 0.00% NA
Aus  269 93.70% 6.30% 0.00% 0.00% NA
Indica I  595 99.70% 0.00% 0.34% 0.00% NA
Indica II  465 99.10% 0.20% 0.65% 0.00% NA
Indica III  913 99.50% 0.30% 0.22% 0.00% NA
Indica Intermediate  786 98.20% 1.50% 0.25% 0.00% NA
Temperate Japonica  767 3.50% 96.10% 0.39% 0.00% NA
Tropical Japonica  504 11.50% 87.90% 0.60% 0.00% NA
Japonica Intermediate  241 29.50% 68.90% 1.66% 0.00% NA
VI/Aromatic  96 11.50% 88.50% 0.00% 0.00% NA
Intermediate  90 54.40% 41.10% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0826601883 T -> G LOC_Os08g42110.1 upstream_gene_variant ; 4808.0bp to feature; MODIFIER silent_mutation Average:75.915; most accessible tissue: Zhenshan97 flag leaf, score: 91.045 N N N N
vg0826601883 T -> G LOC_Os08g42100.1 intron_variant ; MODIFIER silent_mutation Average:75.915; most accessible tissue: Zhenshan97 flag leaf, score: 91.045 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0826601883 T G 0.04 0.03 0.03 0.02 0.03 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0826601883 NA 1.87E-35 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826601883 NA 1.11E-43 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826601883 NA 1.18E-58 mr1695 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826601883 NA 9.58E-52 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826601883 NA 2.45E-13 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826601883 NA 5.62E-24 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826601883 NA 1.52E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826601883 NA 1.49E-22 mr1386_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826601883 2.83E-09 NA mr1549_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826601883 NA 4.32E-19 mr1657_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826601883 NA 6.14E-36 mr1689_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826601883 NA 5.07E-59 mr1695_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826601883 NA 2.73E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826601883 NA 1.32E-06 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251