\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0826557361:

Variant ID: vg0826557361 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 26557361
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


TAATTTACACTTTCTATTATTTTTTTACGTTTAGTTTTTTTTTACCATATGGTTCAAGTTTAGAAAATGGGTTTGGGATATGATTTCTCCCCTCTTAGAG[G/A]
GTAATATTCAATCTGAACCATCGATTCTTCTTACCCCCATTTCATTCTATCTCTCCATTCGTTTTCGTTTTCTAGTCTCACCTATTCTAACTCATTTTCT

Reverse complement sequence

AGAAAATGAGTTAGAATAGGTGAGACTAGAAAACGAAAACGAATGGAGAGATAGAATGAAATGGGGGTAAGAAGAATCGATGGTTCAGATTGAATATTAC[C/T]
CTCTAAGAGGGGAGAAATCATATCCCAAACCCATTTTCTAAACTTGAACCATATGGTAAAAAAAAACTAAACGTAAAAAAATAATAGAAAGTGTAAATTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.60% 42.20% 0.19% 0.00% NA
All Indica  2759 89.20% 10.50% 0.22% 0.00% NA
All Japonica  1512 3.00% 96.90% 0.13% 0.00% NA
Aus  269 65.10% 34.90% 0.00% 0.00% NA
Indica I  595 97.50% 2.40% 0.17% 0.00% NA
Indica II  465 90.50% 9.20% 0.22% 0.00% NA
Indica III  913 84.00% 15.90% 0.11% 0.00% NA
Indica Intermediate  786 88.30% 11.30% 0.38% 0.00% NA
Temperate Japonica  767 2.60% 97.30% 0.13% 0.00% NA
Tropical Japonica  504 2.60% 97.40% 0.00% 0.00% NA
Japonica Intermediate  241 5.00% 94.60% 0.41% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 38.90% 60.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0826557361 G -> A LOC_Os08g42040.1 upstream_gene_variant ; 280.0bp to feature; MODIFIER silent_mutation Average:66.6; most accessible tissue: Minghui63 panicle, score: 88.281 N N N N
vg0826557361 G -> A LOC_Os08g42040.2 upstream_gene_variant ; 281.0bp to feature; MODIFIER silent_mutation Average:66.6; most accessible tissue: Minghui63 panicle, score: 88.281 N N N N
vg0826557361 G -> A LOC_Os08g42050.1 downstream_gene_variant ; 1483.0bp to feature; MODIFIER silent_mutation Average:66.6; most accessible tissue: Minghui63 panicle, score: 88.281 N N N N
vg0826557361 G -> A LOC_Os08g42040-LOC_Os08g42050 intergenic_region ; MODIFIER silent_mutation Average:66.6; most accessible tissue: Minghui63 panicle, score: 88.281 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0826557361 NA 1.80E-08 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826557361 NA 1.27E-27 mr1350_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826557361 NA 6.84E-11 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251