\
| Variant ID: vg0826333758 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 26333758 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, T: 0.09, others allele: 0.00, population size: 107. )
AATTACCACTGTCGAGAAAATATCTCGTTGTTTTTTCATATCATCTAAATAGTTATAAAAAAATTAATAATATAGATTAATATAAAATATATCATTTCAA[G/T]
ACAAACAAGACTAAATTCGACTTTTACAAATTAGAAAAAAAACAAATTAAACTTAAAATATTTATCGTACATCCGCATCTATATTTGTTTTTTTACAACT
AGTTGTAAAAAAACAAATATAGATGCGGATGTACGATAAATATTTTAAGTTTAATTTGTTTTTTTTCTAATTTGTAAAAGTCGAATTTAGTCTTGTTTGT[C/A]
TTGAAATGATATATTTTATATTAATCTATATTATTAATTTTTTTATAACTATTTAGATGATATGAAAAAACAACGAGATATTTTCTCGACAGTGGTAATT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.60% | 33.10% | 0.32% | 0.93% | NA |
| All Indica | 2759 | 79.20% | 19.00% | 0.40% | 1.49% | NA |
| All Japonica | 1512 | 41.30% | 58.40% | 0.07% | 0.20% | NA |
| Aus | 269 | 86.60% | 13.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 64.20% | 35.60% | 0.00% | 0.17% | NA |
| Indica II | 465 | 85.20% | 8.40% | 0.65% | 5.81% | NA |
| Indica III | 913 | 85.50% | 14.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 79.50% | 17.80% | 1.02% | 1.65% | NA |
| Temperate Japonica | 767 | 8.20% | 91.40% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 86.30% | 13.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 52.70% | 46.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 8.30% | 91.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 38.90% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0826333758 | G -> T | LOC_Os08g41720.1 | intron_variant ; MODIFIER | silent_mutation | Average:64.902; most accessible tissue: Callus, score: 92.375 | N | N | N | N |
| vg0826333758 | G -> DEL | N | N | silent_mutation | Average:64.902; most accessible tissue: Callus, score: 92.375 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0826333758 | NA | 3.33E-16 | mr1301 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826333758 | NA | 1.24E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826333758 | NA | 2.58E-07 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826333758 | NA | 1.26E-06 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826333758 | NA | 5.78E-06 | mr1532 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826333758 | NA | 5.76E-10 | mr1533 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826333758 | 3.46E-06 | NA | mr1949 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826333758 | NA | 5.09E-11 | mr1980 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826333758 | NA | 4.94E-10 | mr1993 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826333758 | NA | 6.74E-07 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826333758 | NA | 7.48E-07 | mr1248_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826333758 | NA | 6.76E-07 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826333758 | NA | 9.10E-06 | mr1263_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826333758 | NA | 6.05E-16 | mr1301_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826333758 | NA | 9.01E-06 | mr1603_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826333758 | NA | 4.11E-17 | mr1699_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826333758 | NA | 3.16E-07 | mr1874_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |