Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0826161775:

Variant ID: vg0826161775 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 26161775
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


CGCTGACATGTGGGACCACGCTTTTTATTATTTTTCCGAGATATAATTGACACGTAAGCGCCACATCAATGCCACGTGGGACGAAGACCTAGTCAAACAA[G/A]
CCACGTAAGCGCAACGTCAGTCAAAATCGTCTTCAAAACCGCCGAGGGACTTGTTTACCCGGTTAGCAAGGGACATAAATTGGACTGGGCGACAAATAGA

Reverse complement sequence

TCTATTTGTCGCCCAGTCCAATTTATGTCCCTTGCTAACCGGGTAAACAAGTCCCTCGGCGGTTTTGAAGACGATTTTGACTGACGTTGCGCTTACGTGG[C/T]
TTGTTTGACTAGGTCTTCGTCCCACGTGGCATTGATGTGGCGCTTACGTGTCAATTATATCTCGGAAAAATAATAAAAAGCGTGGTCCCACATGTCAGCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.60% 37.80% 0.55% 0.06% NA
All Indica  2759 42.40% 56.70% 0.80% 0.11% NA
All Japonica  1512 98.70% 1.10% 0.20% 0.00% NA
Aus  269 35.70% 64.30% 0.00% 0.00% NA
Indica I  595 46.90% 52.40% 0.50% 0.17% NA
Indica II  465 64.70% 34.60% 0.65% 0.00% NA
Indica III  913 27.60% 71.10% 1.20% 0.11% NA
Indica Intermediate  786 43.00% 56.20% 0.64% 0.13% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 98.00% 2.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 1.70% 1.24% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 68.90% 30.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0826161775 G -> A LOC_Os08g41420.1 upstream_gene_variant ; 3912.0bp to feature; MODIFIER silent_mutation Average:99.604; most accessible tissue: Zhenshan97 panicle, score: 99.935 N N N N
vg0826161775 G -> A LOC_Os08g41430.1 downstream_gene_variant ; 186.0bp to feature; MODIFIER silent_mutation Average:99.604; most accessible tissue: Zhenshan97 panicle, score: 99.935 N N N N
vg0826161775 G -> A LOC_Os08g41440.1 downstream_gene_variant ; 3234.0bp to feature; MODIFIER silent_mutation Average:99.604; most accessible tissue: Zhenshan97 panicle, score: 99.935 N N N N
vg0826161775 G -> A LOC_Os08g41430-LOC_Os08g41440 intergenic_region ; MODIFIER silent_mutation Average:99.604; most accessible tissue: Zhenshan97 panicle, score: 99.935 N N N N
vg0826161775 G -> DEL N N silent_mutation Average:99.604; most accessible tissue: Zhenshan97 panicle, score: 99.935 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0826161775 G A -0.02 -0.03 -0.02 -0.02 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0826161775 5.14E-06 5.14E-06 mr1048 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826161775 NA 3.32E-06 mr1264 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826161775 NA 8.60E-06 mr1283 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826161775 3.51E-06 6.10E-07 mr1297 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826161775 NA 2.01E-11 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826161775 NA 7.56E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826161775 NA 1.02E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826161775 NA 2.66E-06 mr1433 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826161775 4.56E-06 8.27E-07 mr1433 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826161775 NA 5.11E-06 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826161775 NA 2.83E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826161775 NA 1.14E-08 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826161775 4.03E-06 NA mr1649 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826161775 1.96E-07 3.58E-08 mr1649 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826161775 NA 1.69E-08 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826161775 NA 1.67E-06 mr1687 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826161775 1.37E-06 1.37E-06 mr1953 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251