\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0826159859:

Variant ID: vg0826159859 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 26159859
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


GGGGGATTTTCCTACGCGTTTGGGGGGATTTCTGTTCGTCAATGATTTCTTTGGAGGGCGATTTGGGGTTTTCTACAGGTGGATTCGGCGCGAGGGCATG[G/A]
GGCAGCGAAGAAATGCCCACAGCGCGCGTGCCTCCCTTTTCCCCGGCCGCTCGCGCCCTCGCTGCAACGAAGTATTGCGCCGCTTAGGTAGGGGACGGGA

Reverse complement sequence

TCCCGTCCCCTACCTAAGCGGCGCAATACTTCGTTGCAGCGAGGGCGCGAGCGGCCGGGGAAAAGGGAGGCACGCGCGCTGTGGGCATTTCTTCGCTGCC[C/T]
CATGCCCTCGCGCCGAATCCACCTGTAGAAAACCCCAAATCGCCCTCCAAAGAAATCATTGACGAACAGAAATCCCCCCAAACGCGTAGGAAAATCCCCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.60% 24.40% 0.04% 0.00% NA
All Indica  2759 59.60% 40.40% 0.07% 0.00% NA
All Japonica  1512 98.60% 1.40% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 54.80% 45.20% 0.00% 0.00% NA
Indica II  465 37.40% 62.60% 0.00% 0.00% NA
Indica III  913 73.70% 26.10% 0.22% 0.00% NA
Indica Intermediate  786 59.80% 40.20% 0.00% 0.00% NA
Temperate Japonica  767 97.90% 2.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0826159859 G -> A LOC_Os08g41420.1 upstream_gene_variant ; 1996.0bp to feature; MODIFIER silent_mutation Average:83.295; most accessible tissue: Zhenshan97 flag leaf, score: 92.554 N N N N
vg0826159859 G -> A LOC_Os08g41430.1 upstream_gene_variant ; 13.0bp to feature; MODIFIER silent_mutation Average:83.295; most accessible tissue: Zhenshan97 flag leaf, score: 92.554 N N N N
vg0826159859 G -> A LOC_Os08g41420-LOC_Os08g41430 intergenic_region ; MODIFIER silent_mutation Average:83.295; most accessible tissue: Zhenshan97 flag leaf, score: 92.554 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0826159859 G A -0.04 -0.04 -0.04 -0.04 -0.05 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0826159859 8.60E-06 8.60E-06 mr1048 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826159859 NA 2.52E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826159859 NA 1.73E-06 mr1297 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826159859 3.59E-06 7.31E-07 mr1297 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826159859 9.09E-06 NA mr1305 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826159859 NA 5.66E-06 mr1337 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826159859 NA 5.29E-07 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826159859 NA 5.40E-06 mr1387 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826159859 NA 4.44E-06 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826159859 NA 9.72E-06 mr1433 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826159859 7.05E-06 1.56E-06 mr1433 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826159859 NA 1.14E-09 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826159859 2.58E-07 1.34E-11 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826159859 1.07E-07 2.78E-08 mr1649 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826159859 NA 6.33E-10 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826159859 NA 1.33E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826159859 NA 5.92E-06 mr1759 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826159859 3.73E-06 3.73E-06 mr1953 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251