Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0826158844:

Variant ID: vg0826158844 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 26158844
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:

TGTTTTATGGAGTTGTATTATACAGTAGCCCTCTATAAAAAGTTATTTTATAAATAAATTTTTAGAAAAAAAAATATTTTACAAATAGACTCTTTTCTTA[G/T]
GCTGTGTTCTTTCCTTCGAGTTCTCAACCCCTCTCCCTCGTTTTCCGCGCGCACGCTTTTCAAACTGCTAAATGGTGTGCTTTTTGTAAAAAGTTTCTAT

Reverse complement sequence

ATAGAAACTTTTTACAAAAAGCACACCATTTAGCAGTTTGAAAAGCGTGCGCGCGGAAAACGAGGGAGAGGGGTTGAGAACTCGAAGGAAAGAACACAGC[C/A]
TAAGAAAAGAGTCTATTTGTAAAATATTTTTTTTTCTAAAAATTTATTTATAAAATAACTTTTTATAGAGGGCTACTGTATAATACAACTCCATAAAACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.60%	24.10%	0.28%	0.04%	NA
All Indica	2759	59.60%	39.90%	0.47%	0.07%	NA
All Japonica	1512	98.60%	1.40%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	55.10%	44.40%	0.50%	0.00%	NA
Indica II	465	37.60%	61.50%	0.43%	0.43%	NA
Indica III	913	73.30%	26.20%	0.55%	0.00%	NA
Indica Intermediate	786	59.90%	39.70%	0.38%	0.00%	NA
Temperate Japonica	767	97.90%	2.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	81.10%	18.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0826158844	G -> T	LOC_Os08g41420.1	upstream_gene_variant ; 981.0bp to feature; MODIFIER	silent_mutation	Average:90.493; most accessible tissue: Minghui63 panicle, score: 93.521	N	N	N	N
vg0826158844	G -> T	LOC_Os08g41430.1	upstream_gene_variant ; 1028.0bp to feature; MODIFIER	silent_mutation	Average:90.493; most accessible tissue: Minghui63 panicle, score: 93.521	N	N	N	N
vg0826158844	G -> T	LOC_Os08g41420-LOC_Os08g41430	intergenic_region ; MODIFIER	silent_mutation	Average:90.493; most accessible tissue: Minghui63 panicle, score: 93.521	N	N	N	N
vg0826158844	G -> DEL	N	N	silent_mutation	Average:90.493; most accessible tissue: Minghui63 panicle, score: 93.521	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0826158844	G	T	0.01	0.0	-0.01	-0.01	-0.01	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0826158844	NA	4.44E-06	mr1046	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826158844	NA	2.32E-06	mr1297	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826158844	8.73E-06	1.72E-06	mr1297	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826158844	NA	4.44E-07	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826158844	NA	2.73E-06	mr1387	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826158844	NA	3.67E-06	mr1427	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826158844	NA	2.78E-06	mr1433	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826158844	NA	6.12E-06	mr1512	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826158844	NA	2.89E-07	mr1559	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826158844	4.34E-08	3.17E-12	mr1649	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826158844	7.18E-08	1.90E-08	mr1649	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826158844	NA	8.07E-07	mr1727	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826158844	NA	1.75E-06	mr1759	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826158844	NA	3.37E-06	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826158844	NA	8.92E-06	mr1777	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826158844	4.78E-06	4.78E-06	mr1953	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251