Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0826134475:

Variant ID: vg0826134475 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 26134475
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGACCACTTCGACGCGCTGCTCCTCCCGCTCGCCCGCGCCCGCCTCTTCACCCACCTCTGGTCCCTCGCCGCCGACATGCGCGCCCTCGGCCTCCCGCT[C/T]
TCCCCCTCCACCTTCTCCGCCGTCATCTCCTCCTACGGCCAATCCCGCCTCACCGACCAGGCCGTCGAGGTGTTCAACCGCCTCCCGCGATTCGGCTGCC

Reverse complement sequence

GGCAGCCGAATCGCGGGAGGCGGTTGAACACCTCGACGGCCTGGTCGGTGAGGCGGGATTGGCCGTAGGAGGAGATGACGGCGGAGAAGGTGGAGGGGGA[G/A]
AGCGGGAGGCCGAGGGCGCGCATGTCGGCGGCGAGGGACCAGAGGTGGGTGAAGAGGCGGGCGCGGGCGAGCGGGAGGAGCAGCGCGTCGAAGTGGTCGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.80% 49.00% 0.17% 0.00% NA
All Indica  2759 83.70% 16.00% 0.29% 0.00% NA
All Japonica  1512 2.20% 97.80% 0.00% 0.00% NA
Aus  269 6.70% 93.30% 0.00% 0.00% NA
Indica I  595 89.10% 10.80% 0.17% 0.00% NA
Indica II  465 91.80% 8.20% 0.00% 0.00% NA
Indica III  913 76.00% 23.50% 0.44% 0.00% NA
Indica Intermediate  786 83.70% 15.90% 0.38% 0.00% NA
Temperate Japonica  767 2.30% 97.70% 0.00% 0.00% NA
Tropical Japonica  504 1.60% 98.40% 0.00% 0.00% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 45.60% 54.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0826134475 C -> T LOC_Os08g41380.1 synonymous_variant ; p.Leu147Leu; LOW synonymous_codon Average:96.306; most accessible tissue: Zhenshan97 flag leaf, score: 98.765 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0826134475 C T -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0826134475 NA 2.89E-06 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826134475 NA 1.39E-14 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826134475 NA 2.47E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826134475 NA 1.45E-13 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826134475 NA 3.26E-49 mr1798 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826134475 NA 4.68E-08 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826134475 NA 5.95E-21 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826134475 3.76E-06 NA mr1794_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251