Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0826130413:

Variant ID: vg0826130413 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 26130413
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.08, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:

TGTACTATTATGTGCTTCAATATACAATATTTTTTACATTAATTATATCTAGAAGTGGTCATAATAGGAGCAAAACGTTAAATGATTTTGCTTCCCGATC[G/A]
ATCTTGAGGATCGACAAAGTCACCACACTATCGGTGGATATGTTACCTATCATTGAAAAAAATATATATTGTAACCATAAATACGAGCACATATTTAAAG

Reverse complement sequence

CTTTAAATATGTGCTCGTATTTATGGTTACAATATATATTTTTTTCAATGATAGGTAACATATCCACCGATAGTGTGGTGACTTTGTCGATCCTCAAGAT[C/T]
GATCGGGAAGCAAAATCATTTAACGTTTTGCTCCTATTATGACCACTTCTAGATATAATTAATGTAAAAAATATTGTATATTGAAGCACATAATAGTACA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.50%	40.50%	0.06%	0.00%	NA
All Indica	2759	92.80%	7.10%	0.07%	0.00%	NA
All Japonica	1512	2.20%	97.80%	0.00%	0.00%	NA
Aus	269	63.20%	36.80%	0.00%	0.00%	NA
Indica I	595	89.70%	10.30%	0.00%	0.00%	NA
Indica II	465	98.30%	1.50%	0.22%	0.00%	NA
Indica III	913	94.20%	5.80%	0.00%	0.00%	NA
Indica Intermediate	786	90.20%	9.70%	0.13%	0.00%	NA
Temperate Japonica	767	2.30%	97.70%	0.00%	0.00%	NA
Tropical Japonica	504	1.40%	98.60%	0.00%	0.00%	NA
Japonica Intermediate	241	3.30%	96.70%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	51.10%	47.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0826130413	G -> A	LOC_Os08g41360.1	upstream_gene_variant ; 2483.0bp to feature; MODIFIER	silent_mutation	Average:36.422; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0826130413	G -> A	LOC_Os08g41370.1	upstream_gene_variant ; 2158.0bp to feature; MODIFIER	silent_mutation	Average:36.422; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0826130413	G -> A	LOC_Os08g41380.1	upstream_gene_variant ; 3622.0bp to feature; MODIFIER	silent_mutation	Average:36.422; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0826130413	G -> A	LOC_Os08g41360-LOC_Os08g41370	intergenic_region ; MODIFIER	silent_mutation	Average:36.422; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0826130413	NA	2.98E-06	mr1098	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826130413	NA	2.97E-08	mr1177	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826130413	NA	1.09E-11	mr1180	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826130413	NA	2.04E-11	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826130413	NA	8.60E-11	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826130413	NA	1.14E-07	mr1098_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826130413	NA	3.45E-09	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826130413	NA	1.65E-09	mr1183_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826130413	NA	1.54E-20	mr1627_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251