Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0825972153:

Variant ID: vg0825972153 (JBrowse)	Variation Type: INDEL
Chromosome: chr08	Position: 25972153
Reference Allele: CGA	Alternative Allele: TGA,C
Primary Allele: TGA	Secondary Allele: CGA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTCTTTGGAGTAAATATTAAGAAATCCAGACCTCCATTGCTTTGTTTTCCACAAAAATTCTCTGAGGTTCCTACGTTTGAATCGTGCCTAATAGCCTACA[CGA/TGA,C]
GAGAGAGCTGTGTGCGAGTAAAATTAAGCTGATCTCCATGAGGCTCCAGTATTTACAAGCTTGATGTATGCATCCTTGAAGTCGGCAAAAAATTTAGCTT

Reverse complement sequence

AAGCTAAATTTTTTGCCGACTTCAAGGATGCATACATCAAGCTTGTAAATACTGGAGCCTCATGGAGATCAGCTTAATTTTACTCGCACACAGCTCTCTC[TCG/TCA,G]
TGTAGGCTATTAGGCACGATTCAAACGTAGGAACCTCAGAGAATTTTTGTGGAAAACAAAGCAATGGAGGTCTGGATTTCTTAATATTTACTCCAAAGAC

Allele Frequencies:

Populations	Population Size	Frequency of TGA(primary allele)	Frequency of CGA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.70%	42.80%	0.19%	0.00%	C: 0.28%
All Indica	2759	93.60%	6.10%	0.25%	0.00%	C: 0.04%
All Japonica	1512	2.20%	97.70%	0.07%	0.00%	NA
Aus	269	8.60%	87.00%	0.00%	0.00%	C: 4.46%
Indica I	595	98.50%	1.50%	0.00%	0.00%	NA
Indica II	465	89.70%	9.90%	0.43%	0.00%	NA
Indica III	913	93.00%	6.80%	0.22%	0.00%	NA
Indica Intermediate	786	92.90%	6.60%	0.38%	0.00%	C: 0.13%
Temperate Japonica	767	2.50%	97.40%	0.13%	0.00%	NA
Tropical Japonica	504	1.40%	98.60%	0.00%	0.00%	NA
Japonica Intermediate	241	3.30%	96.70%	0.00%	0.00%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	44.40%	54.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0825972153	CGA -> C	LOC_Os08g41090.1	3_prime_UTR_variant ; 24.0bp to feature; MODIFIER	silent_mutation	Average:53.46; most accessible tissue: Zhenshan97 young leaf, score: 71.065	N	N	N	N
vg0825972153	CGA -> C	LOC_Os08g41080.1	downstream_gene_variant ; 633.0bp to feature; MODIFIER	silent_mutation	Average:53.46; most accessible tissue: Zhenshan97 young leaf, score: 71.065	N	N	N	N
vg0825972153	CGA -> C	LOC_Os08g41100.1	downstream_gene_variant ; 3235.0bp to feature; MODIFIER	silent_mutation	Average:53.46; most accessible tissue: Zhenshan97 young leaf, score: 71.065	N	N	N	N
vg0825972153	CGA -> TGA	LOC_Os08g41090.1	3_prime_UTR_variant ; 26.0bp to feature; MODIFIER	silent_mutation	Average:53.46; most accessible tissue: Zhenshan97 young leaf, score: 71.065	N	N	N	N
vg0825972153	CGA -> TGA	LOC_Os08g41080.1	downstream_gene_variant ; 632.0bp to feature; MODIFIER	silent_mutation	Average:53.46; most accessible tissue: Zhenshan97 young leaf, score: 71.065	N	N	N	N
vg0825972153	CGA -> TGA	LOC_Os08g41100.1	downstream_gene_variant ; 3236.0bp to feature; MODIFIER	silent_mutation	Average:53.46; most accessible tissue: Zhenshan97 young leaf, score: 71.065	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0825972153	NA	1.14E-14	mr1164	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825972153	NA	2.87E-06	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825972153	NA	4.12E-23	mr1943	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825972153	NA	4.15E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825972153	NA	2.39E-62	mr1125_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825972153	NA	1.80E-13	mr1151_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825972153	NA	1.73E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825972153	NA	9.76E-13	mr1217_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825972153	NA	5.66E-11	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825972153	NA	1.11E-07	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825972153	NA	3.14E-23	mr1401_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825972153	8.26E-06	8.26E-06	mr1424_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825972153	NA	3.74E-08	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825972153	3.69E-06	3.69E-06	mr1433_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825972153	NA	9.92E-06	mr1746_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825972153	NA	8.21E-09	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825972153	NA	7.93E-06	mr1762_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825972153	NA	2.39E-07	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825972153	NA	1.10E-08	mr1889_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825972153	NA	2.77E-07	mr1896_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825972153	NA	5.86E-20	mr1922_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825972153	NA	3.25E-21	mr1924_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825972153	NA	2.12E-08	mr1934_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825972153	NA	2.30E-28	mr1943_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825972153	NA	3.83E-07	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251