\
| Variant ID: vg0825960083 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 25960083 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CATACATACATACATACATATATATATGCACGCGCGCGACACACACATATATATGTTTATAGGCTGAAACTTAAGGTGTGCACGTACACTTTTTTATGGC[A/G]
CTTAGAATTTTGTCCTGGAGAAAATTCTGTTGACGGTTGTTTTTCCTTGCTGAGATCTACTTGTTGGGGATGATAAAGTTGATTTGTTGCAACCTGAATA
TATTCAGGTTGCAACAAATCAACTTTATCATCCCCAACAAGTAGATCTCAGCAAGGAAAAACAACCGTCAACAGAATTTTCTCCAGGACAAAATTCTAAG[T/C]
GCCATAAAAAAGTGTACGTGCACACCTTAAGTTTCAGCCTATAAACATATATATGTGTGTGTCGCGCGCGTGCATATATATATGTATGTATGTATGTATG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.80% | 9.20% | 10.98% | 0.02% | NA |
| All Indica | 2759 | 94.90% | 0.30% | 4.86% | 0.04% | NA |
| All Japonica | 1512 | 59.90% | 27.10% | 13.10% | 0.00% | NA |
| Aus | 269 | 36.80% | 0.70% | 62.45% | 0.00% | NA |
| Indica I | 595 | 98.80% | 0.30% | 0.84% | 0.00% | NA |
| Indica II | 465 | 90.80% | 0.00% | 9.25% | 0.00% | NA |
| Indica III | 913 | 93.50% | 0.30% | 6.02% | 0.11% | NA |
| Indica Intermediate | 786 | 95.80% | 0.30% | 3.94% | 0.00% | NA |
| Temperate Japonica | 767 | 32.90% | 49.70% | 17.47% | 0.00% | NA |
| Tropical Japonica | 504 | 92.10% | 1.20% | 6.75% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.40% | 9.10% | 12.45% | 0.00% | NA |
| VI/Aromatic | 96 | 85.40% | 7.30% | 7.29% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 12.20% | 13.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0825960083 | A -> G | LOC_Os08g41070.1 | missense_variant ; p.Cys1241Arg; MODERATE | nonsynonymous_codon ; C1241R | Average:23.363; most accessible tissue: Minghui63 root, score: 40.262 | unknown | unknown | TOLERATED | 1.00 |
| vg0825960083 | A -> DEL | LOC_Os08g41070.1 | N | frameshift_variant | Average:23.363; most accessible tissue: Minghui63 root, score: 40.262 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0825960083 | NA | 3.33E-08 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825960083 | NA | 1.44E-07 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825960083 | 4.91E-06 | 4.90E-06 | mr1261 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825960083 | NA | 1.43E-06 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825960083 | NA | 2.40E-06 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825960083 | 4.48E-08 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825960083 | NA | 4.14E-08 | mr1926 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825960083 | NA | 1.27E-09 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825960083 | NA | 5.35E-07 | mr1977 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825960083 | NA | 6.67E-06 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825960083 | 7.18E-06 | NA | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825960083 | NA | 2.11E-07 | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825960083 | 9.42E-06 | 9.41E-06 | mr1609_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825960083 | NA | 4.02E-07 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |