Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0825816468:

Variant ID: vg0825816468 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 25816468
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACCAGGCTTCATCCTAACCATTACAAGCAAGACATTGTATGAAAAGGGGCGAACATGCAGATTGATAAACTGACGCGTGGTGGACAAGATTGACCGATTT[G/C]
TGACCGGTCTGACACTGGTCATGTCGTCAGCAGACAGCCATGTTCCCACGTCGCGCCTGCTTCCGGCGGAAGTGGAGGTAGGTATGGGCCGTCCCATCAG

Reverse complement sequence

CTGATGGGACGGCCCATACCTACCTCCACTTCCGCCGGAAGCAGGCGCGACGTGGGAACATGGCTGTCTGCTGACGACATGACCAGTGTCAGACCGGTCA[C/G]
AAATCGGTCAATCTTGTCCACCACGCGTCAGTTTATCAATCTGCATGTTCGCCCCTTTTCATACAATGTCTTGCTTGTAATGGTTAGGATGAAGCCTGGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.80%	6.30%	2.86%	8.04%	NA
All Indica	2759	80.10%	10.60%	3.08%	6.23%	NA
All Japonica	1512	98.80%	0.00%	1.06%	0.13%	NA
Aus	269	23.00%	0.70%	6.69%	69.52%	NA
Indica I	595	63.20%	32.30%	4.03%	0.50%	NA
Indica II	465	96.30%	3.20%	0.22%	0.22%	NA
Indica III	913	80.60%	3.50%	4.60%	11.28%	NA
Indica Intermediate	786	82.60%	6.90%	2.29%	8.27%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.00%	0.79%	0.00%	NA
Japonica Intermediate	241	94.20%	0.00%	4.98%	0.83%	NA
VI/Aromatic	96	76.00%	0.00%	14.58%	9.38%	NA
Intermediate	90	83.30%	3.30%	2.22%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0825816468	G -> C	LOC_Os08g40810.1	upstream_gene_variant ; 859.0bp to feature; MODIFIER	silent_mutation	Average:40.891; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0825816468	G -> C	LOC_Os08g40820.1	upstream_gene_variant ; 1293.0bp to feature; MODIFIER	silent_mutation	Average:40.891; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0825816468	G -> C	LOC_Os08g40820.2	upstream_gene_variant ; 1293.0bp to feature; MODIFIER	silent_mutation	Average:40.891; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0825816468	G -> C	LOC_Os08g40820.3	upstream_gene_variant ; 1293.0bp to feature; MODIFIER	silent_mutation	Average:40.891; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0825816468	G -> C	LOC_Os08g40800.1	downstream_gene_variant ; 2422.0bp to feature; MODIFIER	silent_mutation	Average:40.891; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0825816468	G -> C	LOC_Os08g40810-LOC_Os08g40820	intergenic_region ; MODIFIER	silent_mutation	Average:40.891; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0825816468	G -> DEL	N	N	silent_mutation	Average:40.891; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0825816468	NA	4.66E-06	mr1547	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825816468	NA	1.38E-08	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825816468	NA	1.08E-07	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825816468	3.10E-06	NA	mr1874	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825816468	1.28E-06	2.45E-09	mr1874	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825816468	NA	2.29E-08	mr1170_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825816468	NA	9.42E-09	mr1170_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825816468	NA	2.70E-06	mr1272_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825816468	6.89E-06	NA	mr1295_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825816468	7.69E-06	NA	mr1373_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825816468	NA	7.97E-06	mr1551_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825816468	NA	6.10E-18	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825816468	NA	1.80E-13	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825816468	9.09E-07	NA	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825816468	2.41E-06	1.99E-07	mr1754_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825816468	NA	8.00E-06	mr1874_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825816468	NA	2.19E-06	mr1887_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251