\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0825816468:

Variant ID: vg0825816468 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 25816468
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCAGGCTTCATCCTAACCATTACAAGCAAGACATTGTATGAAAAGGGGCGAACATGCAGATTGATAAACTGACGCGTGGTGGACAAGATTGACCGATTT[G/C]
TGACCGGTCTGACACTGGTCATGTCGTCAGCAGACAGCCATGTTCCCACGTCGCGCCTGCTTCCGGCGGAAGTGGAGGTAGGTATGGGCCGTCCCATCAG

Reverse complement sequence

CTGATGGGACGGCCCATACCTACCTCCACTTCCGCCGGAAGCAGGCGCGACGTGGGAACATGGCTGTCTGCTGACGACATGACCAGTGTCAGACCGGTCA[C/G]
AAATCGGTCAATCTTGTCCACCACGCGTCAGTTTATCAATCTGCATGTTCGCCCCTTTTCATACAATGTCTTGCTTGTAATGGTTAGGATGAAGCCTGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.80% 6.30% 2.86% 8.04% NA
All Indica  2759 80.10% 10.60% 3.08% 6.23% NA
All Japonica  1512 98.80% 0.00% 1.06% 0.13% NA
Aus  269 23.00% 0.70% 6.69% 69.52% NA
Indica I  595 63.20% 32.30% 4.03% 0.50% NA
Indica II  465 96.30% 3.20% 0.22% 0.22% NA
Indica III  913 80.60% 3.50% 4.60% 11.28% NA
Indica Intermediate  786 82.60% 6.90% 2.29% 8.27% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.00% 0.79% 0.00% NA
Japonica Intermediate  241 94.20% 0.00% 4.98% 0.83% NA
VI/Aromatic  96 76.00% 0.00% 14.58% 9.38% NA
Intermediate  90 83.30% 3.30% 2.22% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0825816468 G -> C LOC_Os08g40810.1 upstream_gene_variant ; 859.0bp to feature; MODIFIER silent_mutation Average:40.891; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0825816468 G -> C LOC_Os08g40820.1 upstream_gene_variant ; 1293.0bp to feature; MODIFIER silent_mutation Average:40.891; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0825816468 G -> C LOC_Os08g40820.2 upstream_gene_variant ; 1293.0bp to feature; MODIFIER silent_mutation Average:40.891; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0825816468 G -> C LOC_Os08g40820.3 upstream_gene_variant ; 1293.0bp to feature; MODIFIER silent_mutation Average:40.891; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0825816468 G -> C LOC_Os08g40800.1 downstream_gene_variant ; 2422.0bp to feature; MODIFIER silent_mutation Average:40.891; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0825816468 G -> C LOC_Os08g40810-LOC_Os08g40820 intergenic_region ; MODIFIER silent_mutation Average:40.891; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0825816468 G -> DEL N N silent_mutation Average:40.891; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0825816468 NA 4.66E-06 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825816468 NA 1.38E-08 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825816468 NA 1.08E-07 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825816468 3.10E-06 NA mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825816468 1.28E-06 2.45E-09 mr1874 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825816468 NA 2.29E-08 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825816468 NA 9.42E-09 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825816468 NA 2.70E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825816468 6.89E-06 NA mr1295_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825816468 7.69E-06 NA mr1373_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825816468 NA 7.97E-06 mr1551_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825816468 NA 6.10E-18 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825816468 NA 1.80E-13 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825816468 9.09E-07 NA mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825816468 2.41E-06 1.99E-07 mr1754_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825816468 NA 8.00E-06 mr1874_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825816468 NA 2.19E-06 mr1887_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251