\
| Variant ID: vg0825569796 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 25569796 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 120. )
CCACAACAGCGGCAGCAGCAAGCGCGCCGATGACCCGAAGCCGAGGCTCGAGGCGAGGATGACGACGATGAGAAGGCAGCGGCGGTGGTGGCATGCCACC[G/A]
ACTCCCTCTAGCTTGGACCACCTAGGTACAGCTGCAGATGAGCAGGGACGAGGAGCAGGCCCGCCATCAAACAGAGCGGCGGTGTCACGCCCTGAAGTTC
GAACTTCAGGGCGTGACACCGCCGCTCTGTTTGATGGCGGGCCTGCTCCTCGTCCCTGCTCATCTGCAGCTGTACCTAGGTGGTCCAAGCTAGAGGGAGT[C/T]
GGTGGCATGCCACCACCGCCGCTGCCTTCTCATCGTCGTCATCCTCGCCTCGAGCCTCGGCTTCGGGTCATCGGCGCGCTTGCTGCTGCCGCTGTTGTGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.90% | 9.60% | 1.59% | 16.89% | NA |
| All Indica | 2759 | 56.60% | 14.10% | 1.85% | 27.44% | NA |
| All Japonica | 1512 | 97.10% | 0.70% | 0.53% | 1.72% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 27.20% | 31.30% | 3.53% | 37.98% | NA |
| Indica II | 465 | 38.30% | 6.50% | 2.15% | 53.12% | NA |
| Indica III | 913 | 88.40% | 8.00% | 0.22% | 3.40% | NA |
| Indica Intermediate | 786 | 52.70% | 12.80% | 2.29% | 32.19% | NA |
| Temperate Japonica | 767 | 97.30% | 0.80% | 0.65% | 1.30% | NA |
| Tropical Japonica | 504 | 98.80% | 0.00% | 0.40% | 0.79% | NA |
| Japonica Intermediate | 241 | 92.90% | 1.70% | 0.41% | 4.98% | NA |
| VI/Aromatic | 96 | 31.20% | 54.20% | 14.58% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 4.40% | 2.22% | 16.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0825569796 | G -> A | LOC_Os08g40380.1 | upstream_gene_variant ; 4355.0bp to feature; MODIFIER | silent_mutation | Average:30.522; most accessible tissue: Zhenshan97 root, score: 68.908 | N | N | N | N |
| vg0825569796 | G -> A | LOC_Os08g40390.1 | upstream_gene_variant ; 1978.0bp to feature; MODIFIER | silent_mutation | Average:30.522; most accessible tissue: Zhenshan97 root, score: 68.908 | N | N | N | N |
| vg0825569796 | G -> A | LOC_Os08g40390-LOC_Os08g40410 | intergenic_region ; MODIFIER | silent_mutation | Average:30.522; most accessible tissue: Zhenshan97 root, score: 68.908 | N | N | N | N |
| vg0825569796 | G -> DEL | N | N | silent_mutation | Average:30.522; most accessible tissue: Zhenshan97 root, score: 68.908 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0825569796 | 1.44E-12 | 3.74E-18 | mr1874 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825569796 | 1.78E-13 | 2.29E-17 | mr1874 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825569796 | NA | 2.11E-08 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825569796 | 7.69E-09 | NA | mr1874_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825569796 | 4.11E-10 | 6.29E-15 | mr1874_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |