Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0825549651:

Variant ID: vg0825549651 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 25549651
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGTTTTCCACAACACTACTTTAAGCATGACTGAATTTATTTTTAGAAACTAGCACCTATAATATATTATAGGCGTCTTTTTTTAATTAATTGGCACCTAT[G/A]
ACAAATTAAAGGTGTTGGTTTTTTTTTAAAAAAAAGAAAACCAACACCTATAGTATTGGTGTCGGCTCTTCTATAGTCAAAATCTGCTGTGGACGTCTAC

Reverse complement sequence

GTAGACGTCCACAGCAGATTTTGACTATAGAAGAGCCGACACCAATACTATAGGTGTTGGTTTTCTTTTTTTTAAAAAAAAACCAACACCTTTAATTTGT[C/T]
ATAGGTGCCAATTAATTAAAAAAAGACGCCTATAATATATTATAGGTGCTAGTTTCTAAAAATAAATTCAGTCATGCTTAAAGTAGTGTTGTGGAAAACC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.50%	7.50%	4.51%	20.46%	NA
All Indica	2759	64.20%	0.10%	5.47%	30.19%	NA
All Japonica	1512	76.10%	22.50%	0.26%	1.12%	NA
Aus	269	42.00%	0.00%	20.82%	37.17%	NA
Indica I	595	64.90%	0.00%	2.02%	33.11%	NA
Indica II	465	57.60%	0.00%	5.16%	37.20%	NA
Indica III	913	68.50%	0.00%	6.79%	24.75%	NA
Indica Intermediate	786	62.60%	0.50%	6.74%	30.15%	NA
Temperate Japonica	767	66.40%	31.60%	0.52%	1.56%	NA
Tropical Japonica	504	96.40%	3.40%	0.00%	0.20%	NA
Japonica Intermediate	241	64.70%	33.60%	0.00%	1.66%	NA
VI/Aromatic	96	88.50%	7.30%	1.04%	3.12%	NA
Intermediate	90	78.90%	4.40%	1.11%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0825549651	G -> A	LOC_Os08g40350.1	upstream_gene_variant ; 861.0bp to feature; MODIFIER	silent_mutation	Average:13.584; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg0825549651	G -> A	LOC_Os08g40360.1	downstream_gene_variant ; 1686.0bp to feature; MODIFIER	silent_mutation	Average:13.584; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg0825549651	G -> A	LOC_Os08g40350-LOC_Os08g40360	intergenic_region ; MODIFIER	silent_mutation	Average:13.584; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg0825549651	G -> DEL	N	N	silent_mutation	Average:13.584; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0825549651	1.86E-06	7.87E-10	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825549651	NA	3.67E-09	mr1382	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825549651	NA	3.40E-07	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825549651	NA	1.52E-06	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825549651	8.69E-07	NA	mr1676	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825549651	NA	1.67E-08	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825549651	4.80E-06	NA	mr1696	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825549651	NA	4.43E-08	mr1696	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825549651	NA	3.63E-06	mr1707	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825549651	NA	8.77E-06	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825549651	NA	8.45E-06	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251