\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0825549651:

Variant ID: vg0825549651 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 25549651
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGTTTTCCACAACACTACTTTAAGCATGACTGAATTTATTTTTAGAAACTAGCACCTATAATATATTATAGGCGTCTTTTTTTAATTAATTGGCACCTAT[G/A]
ACAAATTAAAGGTGTTGGTTTTTTTTTAAAAAAAAGAAAACCAACACCTATAGTATTGGTGTCGGCTCTTCTATAGTCAAAATCTGCTGTGGACGTCTAC

Reverse complement sequence

GTAGACGTCCACAGCAGATTTTGACTATAGAAGAGCCGACACCAATACTATAGGTGTTGGTTTTCTTTTTTTTAAAAAAAAACCAACACCTTTAATTTGT[C/T]
ATAGGTGCCAATTAATTAAAAAAAGACGCCTATAATATATTATAGGTGCTAGTTTCTAAAAATAAATTCAGTCATGCTTAAAGTAGTGTTGTGGAAAACC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.50% 7.50% 4.51% 20.46% NA
All Indica  2759 64.20% 0.10% 5.47% 30.19% NA
All Japonica  1512 76.10% 22.50% 0.26% 1.12% NA
Aus  269 42.00% 0.00% 20.82% 37.17% NA
Indica I  595 64.90% 0.00% 2.02% 33.11% NA
Indica II  465 57.60% 0.00% 5.16% 37.20% NA
Indica III  913 68.50% 0.00% 6.79% 24.75% NA
Indica Intermediate  786 62.60% 0.50% 6.74% 30.15% NA
Temperate Japonica  767 66.40% 31.60% 0.52% 1.56% NA
Tropical Japonica  504 96.40% 3.40% 0.00% 0.20% NA
Japonica Intermediate  241 64.70% 33.60% 0.00% 1.66% NA
VI/Aromatic  96 88.50% 7.30% 1.04% 3.12% NA
Intermediate  90 78.90% 4.40% 1.11% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0825549651 G -> A LOC_Os08g40350.1 upstream_gene_variant ; 861.0bp to feature; MODIFIER silent_mutation Average:13.584; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg0825549651 G -> A LOC_Os08g40360.1 downstream_gene_variant ; 1686.0bp to feature; MODIFIER silent_mutation Average:13.584; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg0825549651 G -> A LOC_Os08g40350-LOC_Os08g40360 intergenic_region ; MODIFIER silent_mutation Average:13.584; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg0825549651 G -> DEL N N silent_mutation Average:13.584; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0825549651 1.86E-06 7.87E-10 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825549651 NA 3.67E-09 mr1382 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825549651 NA 3.40E-07 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825549651 NA 1.52E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825549651 8.69E-07 NA mr1676 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825549651 NA 1.67E-08 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825549651 4.80E-06 NA mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825549651 NA 4.43E-08 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825549651 NA 3.63E-06 mr1707 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825549651 NA 8.77E-06 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825549651 NA 8.45E-06 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251