\
| Variant ID: vg0825549651 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 25549651 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGTTTTCCACAACACTACTTTAAGCATGACTGAATTTATTTTTAGAAACTAGCACCTATAATATATTATAGGCGTCTTTTTTTAATTAATTGGCACCTAT[G/A]
ACAAATTAAAGGTGTTGGTTTTTTTTTAAAAAAAAGAAAACCAACACCTATAGTATTGGTGTCGGCTCTTCTATAGTCAAAATCTGCTGTGGACGTCTAC
GTAGACGTCCACAGCAGATTTTGACTATAGAAGAGCCGACACCAATACTATAGGTGTTGGTTTTCTTTTTTTTAAAAAAAAACCAACACCTTTAATTTGT[C/T]
ATAGGTGCCAATTAATTAAAAAAAGACGCCTATAATATATTATAGGTGCTAGTTTCTAAAAATAAATTCAGTCATGCTTAAAGTAGTGTTGTGGAAAACC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.50% | 7.50% | 4.51% | 20.46% | NA |
| All Indica | 2759 | 64.20% | 0.10% | 5.47% | 30.19% | NA |
| All Japonica | 1512 | 76.10% | 22.50% | 0.26% | 1.12% | NA |
| Aus | 269 | 42.00% | 0.00% | 20.82% | 37.17% | NA |
| Indica I | 595 | 64.90% | 0.00% | 2.02% | 33.11% | NA |
| Indica II | 465 | 57.60% | 0.00% | 5.16% | 37.20% | NA |
| Indica III | 913 | 68.50% | 0.00% | 6.79% | 24.75% | NA |
| Indica Intermediate | 786 | 62.60% | 0.50% | 6.74% | 30.15% | NA |
| Temperate Japonica | 767 | 66.40% | 31.60% | 0.52% | 1.56% | NA |
| Tropical Japonica | 504 | 96.40% | 3.40% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 64.70% | 33.60% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 88.50% | 7.30% | 1.04% | 3.12% | NA |
| Intermediate | 90 | 78.90% | 4.40% | 1.11% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0825549651 | G -> A | LOC_Os08g40350.1 | upstream_gene_variant ; 861.0bp to feature; MODIFIER | silent_mutation | Average:13.584; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0825549651 | G -> A | LOC_Os08g40360.1 | downstream_gene_variant ; 1686.0bp to feature; MODIFIER | silent_mutation | Average:13.584; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0825549651 | G -> A | LOC_Os08g40350-LOC_Os08g40360 | intergenic_region ; MODIFIER | silent_mutation | Average:13.584; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0825549651 | G -> DEL | N | N | silent_mutation | Average:13.584; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0825549651 | 1.86E-06 | 7.87E-10 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825549651 | NA | 3.67E-09 | mr1382 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825549651 | NA | 3.40E-07 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825549651 | NA | 1.52E-06 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825549651 | 8.69E-07 | NA | mr1676 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825549651 | NA | 1.67E-08 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825549651 | 4.80E-06 | NA | mr1696 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825549651 | NA | 4.43E-08 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825549651 | NA | 3.63E-06 | mr1707 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825549651 | NA | 8.77E-06 | mr1203_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825549651 | NA | 8.45E-06 | mr1613_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |