\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0825542549:

Variant ID: vg0825542549 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 25542549
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.66, G: 0.34, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


AAACTATTCGAATAGCCGTGCCCGTGGTTATGGGCGGTCAACCAGATTCACCGTGATTAGTCTCACCCCTAGTTTAGTCTTTTGAAATTGGATAGTATAG[A/G]
TGGATGGTTGGGCCTGTCGCAACGTGGTATAGCGTTGGACAGTGGATGATTAATATTGATTAATTATTACAATTGTTTAATTCTTTCAACTTCTGTTTAT

Reverse complement sequence

ATAAACAGAAGTTGAAAGAATTAAACAATTGTAATAATTAATCAATATTAATCATCCACTGTCCAACGCTATACCACGTTGCGACAGGCCCAACCATCCA[T/C]
CTATACTATCCAATTTCAAAAGACTAAACTAGGGGTGAGACTAATCACGGTGAATCTGGTTGACCGCCCATAACCACGGGCACGGCTATTCGAATAGTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.50% 38.50% 0.53% 15.51% NA
All Indica  2759 20.20% 53.50% 0.76% 25.48% NA
All Japonica  1512 97.70% 0.90% 0.20% 1.19% NA
Aus  269 0.70% 99.30% 0.00% 0.00% NA
Indica I  595 45.50% 22.50% 0.67% 31.26% NA
Indica II  465 11.60% 35.50% 1.72% 51.18% NA
Indica III  913 9.50% 86.90% 0.33% 3.29% NA
Indica Intermediate  786 18.60% 49.00% 0.76% 31.68% NA
Temperate Japonica  767 97.80% 0.70% 0.13% 1.43% NA
Tropical Japonica  504 98.80% 0.80% 0.00% 0.40% NA
Japonica Intermediate  241 95.00% 2.10% 0.83% 2.07% NA
VI/Aromatic  96 68.80% 31.20% 0.00% 0.00% NA
Intermediate  90 52.20% 33.30% 1.11% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0825542549 A -> G LOC_Os08g40340.1 downstream_gene_variant ; 387.0bp to feature; MODIFIER silent_mutation Average:29.908; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg0825542549 A -> G LOC_Os08g40350.1 downstream_gene_variant ; 1545.0bp to feature; MODIFIER silent_mutation Average:29.908; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg0825542549 A -> G LOC_Os08g40340-LOC_Os08g40350 intergenic_region ; MODIFIER silent_mutation Average:29.908; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg0825542549 A -> DEL N N silent_mutation Average:29.908; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0825542549 NA 1.44E-07 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825542549 NA 5.02E-07 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825542549 NA 6.98E-07 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825542549 NA 1.90E-08 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825542549 NA 6.11E-07 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825542549 NA 1.17E-09 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825542549 NA 4.69E-09 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825542549 5.00E-06 5.00E-06 mr1979_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251