\
| Variant ID: vg0825542549 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 25542549 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.66, G: 0.34, others allele: 0.00, population size: 115. )
AAACTATTCGAATAGCCGTGCCCGTGGTTATGGGCGGTCAACCAGATTCACCGTGATTAGTCTCACCCCTAGTTTAGTCTTTTGAAATTGGATAGTATAG[A/G]
TGGATGGTTGGGCCTGTCGCAACGTGGTATAGCGTTGGACAGTGGATGATTAATATTGATTAATTATTACAATTGTTTAATTCTTTCAACTTCTGTTTAT
ATAAACAGAAGTTGAAAGAATTAAACAATTGTAATAATTAATCAATATTAATCATCCACTGTCCAACGCTATACCACGTTGCGACAGGCCCAACCATCCA[T/C]
CTATACTATCCAATTTCAAAAGACTAAACTAGGGGTGAGACTAATCACGGTGAATCTGGTTGACCGCCCATAACCACGGGCACGGCTATTCGAATAGTTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.50% | 38.50% | 0.53% | 15.51% | NA |
| All Indica | 2759 | 20.20% | 53.50% | 0.76% | 25.48% | NA |
| All Japonica | 1512 | 97.70% | 0.90% | 0.20% | 1.19% | NA |
| Aus | 269 | 0.70% | 99.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 45.50% | 22.50% | 0.67% | 31.26% | NA |
| Indica II | 465 | 11.60% | 35.50% | 1.72% | 51.18% | NA |
| Indica III | 913 | 9.50% | 86.90% | 0.33% | 3.29% | NA |
| Indica Intermediate | 786 | 18.60% | 49.00% | 0.76% | 31.68% | NA |
| Temperate Japonica | 767 | 97.80% | 0.70% | 0.13% | 1.43% | NA |
| Tropical Japonica | 504 | 98.80% | 0.80% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 95.00% | 2.10% | 0.83% | 2.07% | NA |
| VI/Aromatic | 96 | 68.80% | 31.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 33.30% | 1.11% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0825542549 | A -> G | LOC_Os08g40340.1 | downstream_gene_variant ; 387.0bp to feature; MODIFIER | silent_mutation | Average:29.908; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg0825542549 | A -> G | LOC_Os08g40350.1 | downstream_gene_variant ; 1545.0bp to feature; MODIFIER | silent_mutation | Average:29.908; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg0825542549 | A -> G | LOC_Os08g40340-LOC_Os08g40350 | intergenic_region ; MODIFIER | silent_mutation | Average:29.908; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg0825542549 | A -> DEL | N | N | silent_mutation | Average:29.908; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0825542549 | NA | 1.44E-07 | mr1066 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825542549 | NA | 5.02E-07 | mr1532 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825542549 | NA | 6.98E-07 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825542549 | NA | 1.90E-08 | mr1659 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825542549 | NA | 6.11E-07 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825542549 | NA | 1.17E-09 | mr1730 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825542549 | NA | 4.69E-09 | mr1170_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825542549 | 5.00E-06 | 5.00E-06 | mr1979_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |