Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0825542549:

Variant ID: vg0825542549 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 25542549
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.66, G: 0.34, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:

AAACTATTCGAATAGCCGTGCCCGTGGTTATGGGCGGTCAACCAGATTCACCGTGATTAGTCTCACCCCTAGTTTAGTCTTTTGAAATTGGATAGTATAG[A/G]
TGGATGGTTGGGCCTGTCGCAACGTGGTATAGCGTTGGACAGTGGATGATTAATATTGATTAATTATTACAATTGTTTAATTCTTTCAACTTCTGTTTAT

Reverse complement sequence

ATAAACAGAAGTTGAAAGAATTAAACAATTGTAATAATTAATCAATATTAATCATCCACTGTCCAACGCTATACCACGTTGCGACAGGCCCAACCATCCA[T/C]
CTATACTATCCAATTTCAAAAGACTAAACTAGGGGTGAGACTAATCACGGTGAATCTGGTTGACCGCCCATAACCACGGGCACGGCTATTCGAATAGTTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.50%	38.50%	0.53%	15.51%	NA
All Indica	2759	20.20%	53.50%	0.76%	25.48%	NA
All Japonica	1512	97.70%	0.90%	0.20%	1.19%	NA
Aus	269	0.70%	99.30%	0.00%	0.00%	NA
Indica I	595	45.50%	22.50%	0.67%	31.26%	NA
Indica II	465	11.60%	35.50%	1.72%	51.18%	NA
Indica III	913	9.50%	86.90%	0.33%	3.29%	NA
Indica Intermediate	786	18.60%	49.00%	0.76%	31.68%	NA
Temperate Japonica	767	97.80%	0.70%	0.13%	1.43%	NA
Tropical Japonica	504	98.80%	0.80%	0.00%	0.40%	NA
Japonica Intermediate	241	95.00%	2.10%	0.83%	2.07%	NA
VI/Aromatic	96	68.80%	31.20%	0.00%	0.00%	NA
Intermediate	90	52.20%	33.30%	1.11%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0825542549	A -> G	LOC_Os08g40340.1	downstream_gene_variant ; 387.0bp to feature; MODIFIER	silent_mutation	Average:29.908; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg0825542549	A -> G	LOC_Os08g40350.1	downstream_gene_variant ; 1545.0bp to feature; MODIFIER	silent_mutation	Average:29.908; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg0825542549	A -> G	LOC_Os08g40340-LOC_Os08g40350	intergenic_region ; MODIFIER	silent_mutation	Average:29.908; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg0825542549	A -> DEL	N	N	silent_mutation	Average:29.908; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0825542549	NA	1.44E-07	mr1066	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825542549	NA	5.02E-07	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825542549	NA	6.98E-07	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825542549	NA	1.90E-08	mr1659	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825542549	NA	6.11E-07	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825542549	NA	1.17E-09	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825542549	NA	4.69E-09	mr1170_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825542549	5.00E-06	5.00E-06	mr1979_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251