\
| Variant ID: vg0825541162 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 25541162 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.70, T: 0.30, others allele: 0.00, population size: 103. )
GTCGGCGAACGAGCGTGCCGACAAGCTGGAACGCGACCTGGCGGAGGTTCGCGAGGACCTCCAGAAGATGAGGGAGCTGGTGGCCGGTAACGAGCGGCAA[T/C]
GGCGGGGACTCGAGGACCGGATGTCGGAACTCAAGAACAACCTGTCGGGGATCCGTGGGTCGCTGCGGGTCACCTACACCGGTCTTCATCAGCTCGCCGG
CCGGCGAGCTGATGAAGACCGGTGTAGGTGACCCGCAGCGACCCACGGATCCCCGACAGGTTGTTCTTGAGTTCCGACATCCGGTCCTCGAGTCCCCGCC[A/G]
TTGCCGCTCGTTACCGGCCACCAGCTCCCTCATCTTCTGGAGGTCCTCGCGAACCTCCGCCAGGTCGCGTTCCAGCTTGTCGGCACGCTCGTTCGCCGAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.60% | 36.60% | 0.68% | 15.17% | NA |
| All Indica | 2759 | 26.50% | 47.50% | 1.01% | 25.01% | NA |
| All Japonica | 1512 | 74.10% | 24.60% | 0.26% | 0.99% | NA |
| Aus | 269 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 45.70% | 21.80% | 1.18% | 31.26% | NA |
| Indica II | 465 | 18.50% | 28.40% | 2.80% | 50.32% | NA |
| Indica III | 913 | 18.50% | 78.50% | 0.00% | 2.96% | NA |
| Indica Intermediate | 786 | 26.00% | 42.10% | 1.02% | 30.92% | NA |
| Temperate Japonica | 767 | 64.30% | 34.20% | 0.26% | 1.30% | NA |
| Tropical Japonica | 504 | 95.60% | 4.00% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 60.60% | 37.30% | 0.41% | 1.66% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 34.40% | 0.00% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0825541162 | T -> C | LOC_Os08g40340.1 | missense_variant ; p.Trp437Arg; MODERATE | nonsynonymous_codon ; W437R | Average:24.024; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 | unknown | unknown | TOLERATED | 1.00 |
| vg0825541162 | T -> DEL | LOC_Os08g40340.1 | N | frameshift_variant | Average:24.024; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0825541162 | NA | 3.68E-06 | mr1230 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825541162 | NA | 5.52E-07 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825541162 | NA | 1.33E-07 | mr1382 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825541162 | NA | 1.43E-06 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825541162 | NA | 2.45E-07 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825541162 | NA | 4.19E-10 | mr1696 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825541162 | NA | 6.11E-07 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825541162 | NA | 7.64E-06 | mr1707 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825541162 | NA | 3.90E-06 | mr1807 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825541162 | 8.72E-08 | 3.83E-12 | mr1874 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825541162 | NA | 3.75E-06 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825541162 | 8.93E-10 | NA | mr1874_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825541162 | 3.25E-11 | 1.77E-17 | mr1874_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |