\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0825504763:

Variant ID: vg0825504763 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 25504763
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTTTAGCACAAAATAACCAAGAGAATTTTTTGAACCTTTTCTTTTCTTGACCCTTTTTTCTCATATTTTTCTCTTTTATTCCGAGTACGTCCCTGTCGT[C/G]
AAGAATGTTTCCAGGGATTCGGCACCCATTATTTTGCTCACATCGAATACGTCCTTGTCGTCAAGACTGTTTCCAAGGATTCGGTATTCATTTTTTTTTC

Reverse complement sequence

GAAAAAAAAATGAATACCGAATCCTTGGAAACAGTCTTGACGACAAGGACGTATTCGATGTGAGCAAAATAATGGGTGCCGAATCCCTGGAAACATTCTT[G/C]
ACGACAGGGACGTACTCGGAATAAAAGAGAAAAATATGAGAAAAAAGGGTCAAGAAAAGAAAAGGTTCAAAAAATTCTCTTGGTTATTTTGTGCTAAAGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.40% 9.90% 1.69% 0.00% NA
All Indica  2759 98.70% 0.30% 1.05% 0.00% NA
All Japonica  1512 67.10% 29.70% 3.17% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.10% 0.30% 3.53% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.50% 0.50% 1.02% 0.00% NA
Temperate Japonica  767 92.80% 4.30% 2.87% 0.00% NA
Tropical Japonica  504 25.40% 70.80% 3.77% 0.00% NA
Japonica Intermediate  241 72.60% 24.50% 2.90% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 84.40% 12.20% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0825504763 C -> G LOC_Os08g40280.1 downstream_gene_variant ; 2602.0bp to feature; MODIFIER silent_mutation Average:19.665; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg0825504763 C -> G LOC_Os08g40290.1 downstream_gene_variant ; 550.0bp to feature; MODIFIER silent_mutation Average:19.665; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg0825504763 C -> G LOC_Os08g40280-LOC_Os08g40290 intergenic_region ; MODIFIER silent_mutation Average:19.665; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0825504763 NA 9.51E-09 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825504763 NA 4.34E-09 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825504763 NA 5.30E-07 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825504763 NA 6.04E-07 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825504763 NA 1.66E-08 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825504763 NA 3.83E-41 mr1699 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825504763 NA 4.15E-20 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825504763 NA 2.26E-14 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825504763 NA 5.96E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825504763 NA 2.25E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825504763 NA 1.93E-07 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825504763 NA 8.59E-12 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825504763 NA 8.40E-20 mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825504763 NA 4.10E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825504763 NA 8.51E-07 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825504763 NA 9.79E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825504763 NA 4.71E-08 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825504763 NA 1.07E-36 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825504763 NA 7.59E-17 mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825504763 NA 4.52E-09 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825504763 NA 4.51E-15 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825504763 NA 3.43E-12 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825504763 NA 6.40E-13 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825504763 NA 7.60E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825504763 NA 3.34E-23 mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251