Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0825502549:

Variant ID: vg0825502549 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 25502549
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

TAAAACTATATGTATACATAAAAATATATTTAACAATAAATAAAATGATAGAAAAAGAATTAATAATTACTTAAATTTTTTAATAAGACGAATGGTCAAA[C/T]
ATTTTTAAAAAGGTCAGTGGCGTCAAACATTTTGGAACGAAGGGAGTACATAGTTGGATGACCAAACAACAACCTTGTAAAGCCTATATGATTCTCCTGT

Reverse complement sequence

ACAGGAGAATCATATAGGCTTTACAAGGTTGTTGTTTGGTCATCCAACTATGTACTCCCTTCGTTCCAAAATGTTTGACGCCACTGACCTTTTTAAAAAT[G/A]
TTTGACCATTCGTCTTATTAAAAAATTTAAGTAATTATTAATTCTTTTTCTATCATTTTATTTATTGTTAAATATATTTTTATGTATACATATAGTTTTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.30%	21.60%	0.80%	0.36%	NA
All Indica	2759	73.50%	25.60%	0.22%	0.62%	NA
All Japonica	1512	97.30%	1.40%	1.32%	0.00%	NA
Aus	269	4.50%	95.50%	0.00%	0.00%	NA
Indica I	595	68.20%	31.40%	0.00%	0.34%	NA
Indica II	465	44.30%	53.30%	0.65%	1.72%	NA
Indica III	913	95.70%	4.30%	0.00%	0.00%	NA
Indica Intermediate	786	69.10%	29.60%	0.38%	0.89%	NA
Temperate Japonica	767	94.90%	2.50%	2.61%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	71.90%	15.60%	12.50%	0.00%	NA
Intermediate	90	78.90%	21.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0825502549	C -> T	LOC_Os08g40280.1	downstream_gene_variant ; 388.0bp to feature; MODIFIER	silent_mutation	Average:47.737; most accessible tissue: Zhenshan97 root, score: 86.79	N	N	N	N
vg0825502549	C -> T	LOC_Os08g40290.1	downstream_gene_variant ; 2764.0bp to feature; MODIFIER	silent_mutation	Average:47.737; most accessible tissue: Zhenshan97 root, score: 86.79	N	N	N	N
vg0825502549	C -> T	LOC_Os08g40280-LOC_Os08g40290	intergenic_region ; MODIFIER	silent_mutation	Average:47.737; most accessible tissue: Zhenshan97 root, score: 86.79	N	N	N	N
vg0825502549	C -> DEL	N	N	silent_mutation	Average:47.737; most accessible tissue: Zhenshan97 root, score: 86.79	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0825502549	NA	4.48E-06	mr1699	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825502549	1.09E-06	NA	mr1874	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825502549	1.21E-06	4.04E-09	mr1874	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825502549	NA	4.91E-07	mr1699_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825502549	4.76E-06	1.03E-10	mr1874_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251