Variant ID: vg0825471248 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 25471248 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TCAGATGTAACTATATTATAATTGCATTGTAACTACACTGTAACTATGATATAACTTATATAAAACTTGTATTTAACTATTATTTGGTTAGCTAGTACCA[A/G]
GATCTTACGAATGACATATGTGAAAAATTCTTTTTAGTATTTTTTTCTCTTCATACACAAATCTCGACGGGATTCGATGATCACAAATCTGAAAGTTTTG
CAAAACTTTCAGATTTGTGATCATCGAATCCCGTCGAGATTTGTGTATGAAGAGAAAAAAATACTAAAAAGAATTTTTCACATATGTCATTCGTAAGATC[T/C]
TGGTACTAGCTAACCAAATAATAGTTAAATACAAGTTTTATATAAGTTATATCATAGTTACAGTGTAGTTACAATGCAATTATAATATAGTTACATCTGA
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 87.10% | 12.30% | 0.70% | 0.00% | NA |
All Indica | 2759 | 99.40% | 0.30% | 0.36% | 0.00% | NA |
All Japonica | 1512 | 61.80% | 36.80% | 1.39% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 98.80% | 0.20% | 1.01% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.00% | 0.50% | 0.51% | 0.00% | NA |
Temperate Japonica | 767 | 82.90% | 15.90% | 1.17% | 0.00% | NA |
Tropical Japonica | 504 | 26.20% | 72.00% | 1.79% | 0.00% | NA |
Japonica Intermediate | 241 | 68.90% | 29.90% | 1.24% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 81.10% | 16.70% | 2.22% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0825471248 | A -> G | LOC_Os08g40250.1 | downstream_gene_variant ; 3113.0bp to feature; MODIFIER | silent_mutation | Average:48.261; most accessible tissue: Minghui63 flower, score: 74.976 | N | N | N | N |
vg0825471248 | A -> G | LOC_Os08g40250-LOC_Os08g40260 | intergenic_region ; MODIFIER | silent_mutation | Average:48.261; most accessible tissue: Minghui63 flower, score: 74.976 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0825471248 | NA | 7.28E-08 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0825471248 | NA | 2.16E-06 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0825471248 | NA | 2.48E-06 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0825471248 | NA | 1.39E-32 | mr1699 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0825471248 | NA | 2.68E-09 | mr1980 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0825471248 | NA | 4.17E-06 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0825471248 | NA | 3.08E-32 | mr1699_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0825471248 | NA | 3.38E-14 | mr1705_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0825471248 | NA | 1.85E-08 | mr1705_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0825471248 | NA | 4.01E-06 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |