\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0825471248:

Variant ID: vg0825471248 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 25471248
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAGATGTAACTATATTATAATTGCATTGTAACTACACTGTAACTATGATATAACTTATATAAAACTTGTATTTAACTATTATTTGGTTAGCTAGTACCA[A/G]
GATCTTACGAATGACATATGTGAAAAATTCTTTTTAGTATTTTTTTCTCTTCATACACAAATCTCGACGGGATTCGATGATCACAAATCTGAAAGTTTTG

Reverse complement sequence

CAAAACTTTCAGATTTGTGATCATCGAATCCCGTCGAGATTTGTGTATGAAGAGAAAAAAATACTAAAAAGAATTTTTCACATATGTCATTCGTAAGATC[T/C]
TGGTACTAGCTAACCAAATAATAGTTAAATACAAGTTTTATATAAGTTATATCATAGTTACAGTGTAGTTACAATGCAATTATAATATAGTTACATCTGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.10% 12.30% 0.70% 0.00% NA
All Indica  2759 99.40% 0.30% 0.36% 0.00% NA
All Japonica  1512 61.80% 36.80% 1.39% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.80% 0.20% 1.01% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.00% 0.50% 0.51% 0.00% NA
Temperate Japonica  767 82.90% 15.90% 1.17% 0.00% NA
Tropical Japonica  504 26.20% 72.00% 1.79% 0.00% NA
Japonica Intermediate  241 68.90% 29.90% 1.24% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 81.10% 16.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0825471248 A -> G LOC_Os08g40250.1 downstream_gene_variant ; 3113.0bp to feature; MODIFIER silent_mutation Average:48.261; most accessible tissue: Minghui63 flower, score: 74.976 N N N N
vg0825471248 A -> G LOC_Os08g40250-LOC_Os08g40260 intergenic_region ; MODIFIER silent_mutation Average:48.261; most accessible tissue: Minghui63 flower, score: 74.976 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0825471248 NA 7.28E-08 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825471248 NA 2.16E-06 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825471248 NA 2.48E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825471248 NA 1.39E-32 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825471248 NA 2.68E-09 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825471248 NA 4.17E-06 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825471248 NA 3.08E-32 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825471248 NA 3.38E-14 mr1705_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825471248 NA 1.85E-08 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825471248 NA 4.01E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251