\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0825436815:

Variant ID: vg0825436815 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 25436815
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.02, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


CTGGATGTAACTGCAAGTTACTCCATCCATTCCAGGATACAAGACGTGATTTTAGTCAAAGTTAAATTATTTTAAATTTAACTAAGTTTATAGATAAATA[A/C]
AATAATATTTATAATACTAAATTAGTTTCGTCAAATCAATAATTGAATATATTTTCATAATAAATTTGTCTTGGGTTGAAAATGTTACTACTTTTTTCTA

Reverse complement sequence

TAGAAAAAAGTAGTAACATTTTCAACCCAAGACAAATTTATTATGAAAATATATTCAATTATTGATTTGACGAAACTAATTTAGTATTATAAATATTATT[T/G]
TATTTATCTATAAACTTAGTTAAATTTAAAATAATTTAACTTTGACTAAAATCACGTCTTGTATCCTGGAATGGATGGAGTAACTTGCAGTTACATCCAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.50% 46.30% 1.18% 0.06% NA
All Indica  2759 56.80% 41.50% 1.67% 0.11% NA
All Japonica  1512 39.80% 59.50% 0.66% 0.00% NA
Aus  269 94.80% 5.20% 0.00% 0.00% NA
Indica I  595 27.70% 72.30% 0.00% 0.00% NA
Indica II  465 30.10% 64.10% 5.59% 0.22% NA
Indica III  913 89.80% 8.80% 1.31% 0.11% NA
Indica Intermediate  786 56.10% 42.70% 1.02% 0.13% NA
Temperate Japonica  767 18.50% 80.70% 0.78% 0.00% NA
Tropical Japonica  504 74.00% 25.40% 0.60% 0.00% NA
Japonica Intermediate  241 36.10% 63.50% 0.41% 0.00% NA
VI/Aromatic  96 8.30% 91.70% 0.00% 0.00% NA
Intermediate  90 54.40% 45.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0825436815 A -> C LOC_Os08g40200.1 upstream_gene_variant ; 282.0bp to feature; MODIFIER silent_mutation Average:65.557; most accessible tissue: Callus, score: 89.02 N N N N
vg0825436815 A -> C LOC_Os08g40190.1 downstream_gene_variant ; 481.0bp to feature; MODIFIER silent_mutation Average:65.557; most accessible tissue: Callus, score: 89.02 N N N N
vg0825436815 A -> C LOC_Os08g40210.1 downstream_gene_variant ; 4407.0bp to feature; MODIFIER silent_mutation Average:65.557; most accessible tissue: Callus, score: 89.02 N N N N
vg0825436815 A -> C LOC_Os08g40190-LOC_Os08g40200 intergenic_region ; MODIFIER silent_mutation Average:65.557; most accessible tissue: Callus, score: 89.02 N N N N
vg0825436815 A -> DEL N N silent_mutation Average:65.557; most accessible tissue: Callus, score: 89.02 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0825436815 3.99E-06 4.50E-11 mr1993 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825436815 NA 2.24E-07 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251