\
| Variant ID: vg0825399481 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 25399481 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, C: 0.03, others allele: 0.00, population size: 286. )
ATAGCTAGCTAGGTACGGTTGTTGTCTCTCTTGAGAATGATGCATGCCATCATATAGTGAGCTTCTGCTTGTCGATCTGCATGATGAAATGATATGAAAT[C/A]
TCGTGTGCATCTGCATGTACCTTTTAATCATCATCTGTCCTTGTACTGTACATTGCAGAAATCAGAAACATTTCAGACAGAAAAGTAGAATAGCAGCATG
CATGCTGCTATTCTACTTTTCTGTCTGAAATGTTTCTGATTTCTGCAATGTACAGTACAAGGACAGATGATGATTAAAAGGTACATGCAGATGCACACGA[G/T]
ATTTCATATCATTTCATCATGCAGATCGACAAGCAGAAGCTCACTATATGATGGCATGCATCATTCTCAAGAGAGACAACAACCGTACCTAGCTAGCTAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.00% | 31.50% | 0.11% | 0.34% | NA |
| All Indica | 2759 | 56.30% | 43.20% | 0.14% | 0.40% | NA |
| All Japonica | 1512 | 98.70% | 1.20% | 0.00% | 0.13% | NA |
| Aus | 269 | 5.60% | 94.10% | 0.37% | 0.00% | NA |
| Indica I | 595 | 89.60% | 10.30% | 0.00% | 0.17% | NA |
| Indica II | 465 | 70.80% | 28.60% | 0.00% | 0.65% | NA |
| Indica III | 913 | 21.40% | 77.80% | 0.22% | 0.66% | NA |
| Indica Intermediate | 786 | 63.00% | 36.60% | 0.25% | 0.13% | NA |
| Temperate Japonica | 767 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 1.20% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 23.30% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0825399481 | C -> A | LOC_Os08g40130.1 | upstream_gene_variant ; 367.0bp to feature; MODIFIER | silent_mutation | Average:60.258; most accessible tissue: Callus, score: 86.988 | N | N | N | N |
| vg0825399481 | C -> A | LOC_Os08g40140.1 | upstream_gene_variant ; 1767.0bp to feature; MODIFIER | silent_mutation | Average:60.258; most accessible tissue: Callus, score: 86.988 | N | N | N | N |
| vg0825399481 | C -> A | LOC_Os08g40140.2 | upstream_gene_variant ; 1767.0bp to feature; MODIFIER | silent_mutation | Average:60.258; most accessible tissue: Callus, score: 86.988 | N | N | N | N |
| vg0825399481 | C -> A | LOC_Os08g40120.1 | downstream_gene_variant ; 1849.0bp to feature; MODIFIER | silent_mutation | Average:60.258; most accessible tissue: Callus, score: 86.988 | N | N | N | N |
| vg0825399481 | C -> A | LOC_Os08g40120-LOC_Os08g40130 | intergenic_region ; MODIFIER | silent_mutation | Average:60.258; most accessible tissue: Callus, score: 86.988 | N | N | N | N |
| vg0825399481 | C -> DEL | N | N | silent_mutation | Average:60.258; most accessible tissue: Callus, score: 86.988 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0825399481 | NA | 6.54E-11 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0825399481 | NA | 2.97E-16 | Heading_date | Ind_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0825399481 | NA | 8.02E-06 | mr1066 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825399481 | NA | 1.81E-10 | mr1110 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825399481 | NA | 1.53E-08 | mr1112 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825399481 | NA | 2.35E-07 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825399481 | NA | 9.68E-07 | mr1532 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825399481 | NA | 2.08E-06 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825399481 | NA | 1.05E-09 | mr1730 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825399481 | NA | 2.13E-06 | mr1215_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825399481 | NA | 9.34E-08 | mr1218_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825399481 | NA | 2.89E-09 | mr1221_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825399481 | NA | 5.90E-09 | mr1388_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825399481 | NA | 3.36E-06 | mr1511_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825399481 | NA | 6.70E-08 | mr1583_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825399481 | NA | 1.96E-06 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825399481 | NA | 2.19E-06 | mr1844_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825399481 | NA | 6.37E-08 | mr1870_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |