\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0825399481:

Variant ID: vg0825399481 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 25399481
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, C: 0.03, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


ATAGCTAGCTAGGTACGGTTGTTGTCTCTCTTGAGAATGATGCATGCCATCATATAGTGAGCTTCTGCTTGTCGATCTGCATGATGAAATGATATGAAAT[C/A]
TCGTGTGCATCTGCATGTACCTTTTAATCATCATCTGTCCTTGTACTGTACATTGCAGAAATCAGAAACATTTCAGACAGAAAAGTAGAATAGCAGCATG

Reverse complement sequence

CATGCTGCTATTCTACTTTTCTGTCTGAAATGTTTCTGATTTCTGCAATGTACAGTACAAGGACAGATGATGATTAAAAGGTACATGCAGATGCACACGA[G/T]
ATTTCATATCATTTCATCATGCAGATCGACAAGCAGAAGCTCACTATATGATGGCATGCATCATTCTCAAGAGAGACAACAACCGTACCTAGCTAGCTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.00% 31.50% 0.11% 0.34% NA
All Indica  2759 56.30% 43.20% 0.14% 0.40% NA
All Japonica  1512 98.70% 1.20% 0.00% 0.13% NA
Aus  269 5.60% 94.10% 0.37% 0.00% NA
Indica I  595 89.60% 10.30% 0.00% 0.17% NA
Indica II  465 70.80% 28.60% 0.00% 0.65% NA
Indica III  913 21.40% 77.80% 0.22% 0.66% NA
Indica Intermediate  786 63.00% 36.60% 0.25% 0.13% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.20% 0.00% 0.40% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 73.30% 23.30% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0825399481 C -> A LOC_Os08g40130.1 upstream_gene_variant ; 367.0bp to feature; MODIFIER silent_mutation Average:60.258; most accessible tissue: Callus, score: 86.988 N N N N
vg0825399481 C -> A LOC_Os08g40140.1 upstream_gene_variant ; 1767.0bp to feature; MODIFIER silent_mutation Average:60.258; most accessible tissue: Callus, score: 86.988 N N N N
vg0825399481 C -> A LOC_Os08g40140.2 upstream_gene_variant ; 1767.0bp to feature; MODIFIER silent_mutation Average:60.258; most accessible tissue: Callus, score: 86.988 N N N N
vg0825399481 C -> A LOC_Os08g40120.1 downstream_gene_variant ; 1849.0bp to feature; MODIFIER silent_mutation Average:60.258; most accessible tissue: Callus, score: 86.988 N N N N
vg0825399481 C -> A LOC_Os08g40120-LOC_Os08g40130 intergenic_region ; MODIFIER silent_mutation Average:60.258; most accessible tissue: Callus, score: 86.988 N N N N
vg0825399481 C -> DEL N N silent_mutation Average:60.258; most accessible tissue: Callus, score: 86.988 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0825399481 NA 6.54E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0825399481 NA 2.97E-16 Heading_date Ind_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0825399481 NA 8.02E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825399481 NA 1.81E-10 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825399481 NA 1.53E-08 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825399481 NA 2.35E-07 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825399481 NA 9.68E-07 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825399481 NA 2.08E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825399481 NA 1.05E-09 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825399481 NA 2.13E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825399481 NA 9.34E-08 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825399481 NA 2.89E-09 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825399481 NA 5.90E-09 mr1388_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825399481 NA 3.36E-06 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825399481 NA 6.70E-08 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825399481 NA 1.96E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825399481 NA 2.19E-06 mr1844_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825399481 NA 6.37E-08 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251