\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0825340502:

Variant ID: vg0825340502 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 25340502
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


CAGATCTCTATACATCCCATCAGCGTTGGGCTAAATAAAAATGCTACTAATATGTTTAGCATTCTCTCTTGCATTTGAATCCGGTTAGGAATGCATATTG[C/T]
TTTCTACTGGCTAGTTTTGATTCCAATGTCATGGTGTCAGGATGGCATGCAGCAGATACAATTAATGTGTCCGATTCAAAAATCACAATGTGTCCGATTC

Reverse complement sequence

GAATCGGACACATTGTGATTTTTGAATCGGACACATTAATTGTATCTGCTGCATGCCATCCTGACACCATGACATTGGAATCAAAACTAGCCAGTAGAAA[G/A]
CAATATGCATTCCTAACCGGATTCAAATGCAAGAGAGAATGCTAAACATATTAGTAGCATTTTTATTTAGCCCAACGCTGATGGGATGTATAGAGATCTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.20% 45.50% 0.32% 0.00% NA
All Indica  2759 75.90% 23.60% 0.47% 0.00% NA
All Japonica  1512 20.90% 79.00% 0.07% 0.00% NA
Aus  269 6.30% 93.70% 0.00% 0.00% NA
Indica I  595 79.30% 19.80% 0.84% 0.00% NA
Indica II  465 89.70% 10.30% 0.00% 0.00% NA
Indica III  913 75.70% 23.70% 0.66% 0.00% NA
Indica Intermediate  786 65.40% 34.40% 0.25% 0.00% NA
Temperate Japonica  767 8.10% 91.90% 0.00% 0.00% NA
Tropical Japonica  504 39.70% 60.30% 0.00% 0.00% NA
Japonica Intermediate  241 22.40% 77.20% 0.41% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 51.10% 47.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0825340502 C -> T LOC_Os08g40000.1 upstream_gene_variant ; 3033.0bp to feature; MODIFIER silent_mutation Average:28.161; most accessible tissue: Minghui63 flower, score: 46.748 N N N N
vg0825340502 C -> T LOC_Os08g40010.1 upstream_gene_variant ; 598.0bp to feature; MODIFIER silent_mutation Average:28.161; most accessible tissue: Minghui63 flower, score: 46.748 N N N N
vg0825340502 C -> T LOC_Os08g40020.1 upstream_gene_variant ; 4203.0bp to feature; MODIFIER silent_mutation Average:28.161; most accessible tissue: Minghui63 flower, score: 46.748 N N N N
vg0825340502 C -> T LOC_Os08g40000-LOC_Os08g40010 intergenic_region ; MODIFIER silent_mutation Average:28.161; most accessible tissue: Minghui63 flower, score: 46.748 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0825340502 NA 9.03E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825340502 NA 1.60E-06 mr1212 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825340502 NA 8.54E-07 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825340502 NA 9.10E-09 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825340502 NA 3.22E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825340502 NA 6.25E-08 mr1536 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825340502 NA 5.05E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825340502 NA 4.34E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825340502 NA 2.69E-08 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825340502 NA 7.67E-06 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825340502 NA 2.39E-07 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825340502 NA 8.55E-07 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825340502 NA 5.42E-08 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825340502 NA 5.97E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251