\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0825302529:

Variant ID: vg0825302529 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 25302529
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTCCTGCGTTCGCCTGTTCCCACACTTGTGACAATGCGTGCCTGTCCTTACACGCGCTCAGCCCAGATGGAGAGCGGAGCTCAATTTGGGCTTTTCTAG[A/C]
GGGTCTGGCTCGGGATGCTATTTTGCACGAGCCTACGATGCTGTTTTGTCGGGCTCCGACTGCGATGCATGCAACCGAACAACCAATGACTACCGTGCGT

Reverse complement sequence

ACGCACGGTAGTCATTGGTTGTTCGGTTGCATGCATCGCAGTCGGAGCCCGACAAAACAGCATCGTAGGCTCGTGCAAAATAGCATCCCGAGCCAGACCC[T/G]
CTAGAAAAGCCCAAATTGAGCTCCGCTCTCCATCTGGGCTGAGCGCGTGTAAGGACAGGCACGCATTGTCACAAGTGTGGGAACAGGCGAACGCAGGAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.60% 29.30% 1.12% 0.00% NA
All Indica  2759 96.20% 3.40% 0.40% 0.00% NA
All Japonica  1512 19.60% 77.80% 2.51% 0.00% NA
Aus  269 94.10% 5.90% 0.00% 0.00% NA
Indica I  595 91.40% 8.10% 0.50% 0.00% NA
Indica II  465 98.50% 0.90% 0.65% 0.00% NA
Indica III  913 98.00% 1.90% 0.11% 0.00% NA
Indica Intermediate  786 96.20% 3.30% 0.51% 0.00% NA
Temperate Japonica  767 5.60% 91.30% 3.13% 0.00% NA
Tropical Japonica  504 43.80% 54.20% 1.98% 0.00% NA
Japonica Intermediate  241 13.70% 84.60% 1.66% 0.00% NA
VI/Aromatic  96 28.10% 70.80% 1.04% 0.00% NA
Intermediate  90 64.40% 32.20% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0825302529 A -> C LOC_Os08g39930.1 upstream_gene_variant ; 240.0bp to feature; MODIFIER silent_mutation Average:92.087; most accessible tissue: Zhenshan97 panicle, score: 99.332 N N N N
vg0825302529 A -> C LOC_Os08g39930-LOC_Os08g39940 intergenic_region ; MODIFIER silent_mutation Average:92.087; most accessible tissue: Zhenshan97 panicle, score: 99.332 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0825302529 A C -0.23 -0.14 -0.09 -0.08 -0.1 -0.12

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0825302529 NA 2.66E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825302529 NA 6.90E-07 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825302529 5.99E-06 NA mr1266 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825302529 1.04E-07 1.04E-07 mr1266 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825302529 NA 1.20E-08 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825302529 5.44E-06 7.33E-14 mr1307 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825302529 NA 1.16E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825302529 NA 3.02E-13 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825302529 NA 9.73E-06 mr1388 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825302529 NA 3.18E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825302529 NA 1.33E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825302529 NA 8.06E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825302529 NA 3.81E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825302529 NA 1.57E-06 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825302529 NA 9.13E-09 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825302529 NA 1.60E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825302529 NA 2.21E-07 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825302529 NA 5.01E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825302529 NA 8.58E-12 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825302529 NA 2.77E-09 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825302529 NA 1.82E-08 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825302529 NA 5.81E-06 mr1791 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825302529 NA 1.30E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825302529 NA 6.10E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251