\
| Variant ID: vg0825239616 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 25239616 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACGCCGGCGGCCGCTCTCCATGGCCTCTAGCCTTGAGCTCCGCCGCCCATTCCCCTTCTGCCCTCTCTCACTCTCTCGTATAATCAGAATAGGTGCCTGA[C/T]
AGGTAGGGCCCACCATTTTTATTATTGTTATTTCCATGTTGGACTGCCACATCAATCAAACCAGTGTCATGTGTGCGCCACGTCAAACCAAAACCACCCC
GGGGTGGTTTTGGTTTGACGTGGCGCACACATGACACTGGTTTGATTGATGTGGCAGTCCAACATGGAAATAACAATAATAAAAATGGTGGGCCCTACCT[G/A]
TCAGGCACCTATTCTGATTATACGAGAGAGTGAGAGAGGGCAGAAGGGGAATGGGCGGCGGAGCTCAAGGCTAGAGGCCATGGAGAGCGGCCGCCGGCGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 91.50% | 8.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 79.60% | 20.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 85.40% | 14.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0825239616 | C -> T | LOC_Os08g39850.1 | upstream_gene_variant ; 1290.0bp to feature; MODIFIER | silent_mutation | Average:55.203; most accessible tissue: Minghui63 root, score: 65.927 | N | N | N | N |
| vg0825239616 | C -> T | LOC_Os08g39850.3 | upstream_gene_variant ; 1290.0bp to feature; MODIFIER | silent_mutation | Average:55.203; most accessible tissue: Minghui63 root, score: 65.927 | N | N | N | N |
| vg0825239616 | C -> T | LOC_Os08g39850.4 | upstream_gene_variant ; 4798.0bp to feature; MODIFIER | silent_mutation | Average:55.203; most accessible tissue: Minghui63 root, score: 65.927 | N | N | N | N |
| vg0825239616 | C -> T | LOC_Os08g39850.2 | upstream_gene_variant ; 4798.0bp to feature; MODIFIER | silent_mutation | Average:55.203; most accessible tissue: Minghui63 root, score: 65.927 | N | N | N | N |
| vg0825239616 | C -> T | LOC_Os08g39840-LOC_Os08g39850 | intergenic_region ; MODIFIER | silent_mutation | Average:55.203; most accessible tissue: Minghui63 root, score: 65.927 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0825239616 | NA | 6.76E-08 | mr1112 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825239616 | 1.36E-06 | NA | mr1874 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825239616 | NA | 2.95E-06 | mr1533_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825239616 | NA | 8.18E-06 | mr1699_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825239616 | NA | 1.04E-06 | mr1874_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |