\
| Variant ID: vg0825196323 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 25196323 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.08, others allele: 0.00, population size: 236. )
CGACGAAGCTGGATGACATAGTAGTAGAACCTTGAGCACCAAGTGCCCCTACCTGGCGCGCCACTGTCGACGGGTGATACCCGTAGACCGGATATAGAGG[A/G]
TATTGGGGTACGTTGGTACAGGATCTACGTAAGACGACATCAAGCAGACAAAAGACGAAGATTATACTGGTTCAGGCCCCTTGATAGGTAATAGCCCTAA
TTAGGGCTATTACCTATCAAGGGGCCTGAACCAGTATAATCTTCGTCTTTTGTCTGCTTGATGTCGTCTTACGTAGATCCTGTACCAACGTACCCCAATA[T/C]
CCTCTATATCCGGTCTACGGGTATCACCCGTCGACAGTGGCGCGCCAGGTAGGGGCACTTGGTGCTCAAGGTTCTACTACTATGTCATCCAGCTTCGTCG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.70% | 31.10% | 0.13% | 0.06% | NA |
| All Indica | 2759 | 56.80% | 43.00% | 0.18% | 0.11% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 6.70% | 93.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 65.90% | 33.60% | 0.34% | 0.17% | NA |
| Indica II | 465 | 75.90% | 24.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 39.20% | 60.70% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 58.90% | 40.60% | 0.38% | 0.13% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 21.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0825196323 | A -> G | LOC_Os08g39810.1 | synonymous_variant ; p.Tyr448Tyr; LOW | synonymous_codon | Average:47.608; most accessible tissue: Minghui63 root, score: 58.187 | N | N | N | N |
| vg0825196323 | A -> DEL | LOC_Os08g39810.1 | N | frameshift_variant | Average:47.608; most accessible tissue: Minghui63 root, score: 58.187 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0825196323 | NA | 2.70E-07 | mr1545 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825196323 | NA | 2.13E-06 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825196323 | NA | 2.68E-06 | mr1699 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825196323 | 2.45E-18 | 6.15E-43 | mr1874 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825196323 | 3.27E-17 | 2.00E-24 | mr1874 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825196323 | NA | 9.89E-08 | mr1004_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825196323 | NA | 4.93E-18 | mr1587_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825196323 | 8.90E-08 | NA | mr1699_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825196323 | 1.27E-07 | 9.11E-11 | mr1699_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825196323 | 7.81E-21 | 1.42E-63 | mr1874_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825196323 | 5.34E-19 | 1.36E-32 | mr1874_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |