\
| Variant ID: vg0825168314 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 25168314 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 126. )
CAGTCTTGTCCGAGTAGAACTCTTTCCATCTCGTAAATTCCGTGAAGGATTTCCTTAATGTGTGCAGAGAATATCCGTATGCGCGTGGGTATGCCATACT[G/A]
ATATGCGACGTATATCGAAGGGTAAAGGGTATACCTAACCCGTAACCCTGACAGTAGCCCCTGACTTCTGCTTAAATGAACTCGTGTAACCATTCGCGAC
GTCGCGAATGGTTACACGAGTTCATTTAAGCAGAAGTCAGGGGCTACTGTCAGGGTTACGGGTTAGGTATACCCTTTACCCTTCGATATACGTCGCATAT[C/T]
AGTATGGCATACCCACGCGCATACGGATATTCTCTGCACACATTAAGGAAATCCTTCACGGAATTTACGAGATGGAAAGAGTTCTACTCGGACAAGACTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.20% | 7.90% | 0.30% | 0.66% | NA |
| All Indica | 2759 | 85.20% | 13.20% | 0.51% | 1.12% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 69.70% | 26.10% | 1.34% | 2.86% | NA |
| Indica II | 465 | 95.90% | 3.90% | 0.00% | 0.22% | NA |
| Indica III | 913 | 85.40% | 13.50% | 0.22% | 0.88% | NA |
| Indica Intermediate | 786 | 90.30% | 8.50% | 0.51% | 0.64% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0825168314 | G -> A | LOC_Os08g39750.1 | upstream_gene_variant ; 444.0bp to feature; MODIFIER | silent_mutation | Average:46.596; most accessible tissue: Zhenshan97 root, score: 61.518 | N | N | N | N |
| vg0825168314 | G -> A | LOC_Os08g39760.1 | downstream_gene_variant ; 4486.0bp to feature; MODIFIER | silent_mutation | Average:46.596; most accessible tissue: Zhenshan97 root, score: 61.518 | N | N | N | N |
| vg0825168314 | G -> A | LOC_Os08g39740-LOC_Os08g39750 | intergenic_region ; MODIFIER | silent_mutation | Average:46.596; most accessible tissue: Zhenshan97 root, score: 61.518 | N | N | N | N |
| vg0825168314 | G -> DEL | N | N | silent_mutation | Average:46.596; most accessible tissue: Zhenshan97 root, score: 61.518 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0825168314 | 8.80E-06 | NA | mr1111 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825168314 | 3.05E-06 | NA | mr1111 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825168314 | 6.91E-06 | NA | mr1237 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825168314 | NA | 6.98E-08 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825168314 | NA | 4.29E-07 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825168314 | 9.83E-06 | NA | mr1874 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825168314 | 8.14E-06 | 4.11E-10 | mr1874 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825168314 | NA | 1.80E-12 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825168314 | NA | 4.30E-09 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825168314 | 5.57E-10 | 1.78E-17 | mr1874_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825168314 | 1.33E-09 | 1.02E-14 | mr1874_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |