Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0825168314:

Variant ID: vg0825168314 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 25168314
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:

CAGTCTTGTCCGAGTAGAACTCTTTCCATCTCGTAAATTCCGTGAAGGATTTCCTTAATGTGTGCAGAGAATATCCGTATGCGCGTGGGTATGCCATACT[G/A]
ATATGCGACGTATATCGAAGGGTAAAGGGTATACCTAACCCGTAACCCTGACAGTAGCCCCTGACTTCTGCTTAAATGAACTCGTGTAACCATTCGCGAC

Reverse complement sequence

GTCGCGAATGGTTACACGAGTTCATTTAAGCAGAAGTCAGGGGCTACTGTCAGGGTTACGGGTTAGGTATACCCTTTACCCTTCGATATACGTCGCATAT[C/T]
AGTATGGCATACCCACGCGCATACGGATATTCTCTGCACACATTAAGGAAATCCTTCACGGAATTTACGAGATGGAAAGAGTTCTACTCGGACAAGACTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.20%	7.90%	0.30%	0.66%	NA
All Indica	2759	85.20%	13.20%	0.51%	1.12%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	69.70%	26.10%	1.34%	2.86%	NA
Indica II	465	95.90%	3.90%	0.00%	0.22%	NA
Indica III	913	85.40%	13.50%	0.22%	0.88%	NA
Indica Intermediate	786	90.30%	8.50%	0.51%	0.64%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0825168314	G -> A	LOC_Os08g39750.1	upstream_gene_variant ; 444.0bp to feature; MODIFIER	silent_mutation	Average:46.596; most accessible tissue: Zhenshan97 root, score: 61.518	N	N	N	N
vg0825168314	G -> A	LOC_Os08g39760.1	downstream_gene_variant ; 4486.0bp to feature; MODIFIER	silent_mutation	Average:46.596; most accessible tissue: Zhenshan97 root, score: 61.518	N	N	N	N
vg0825168314	G -> A	LOC_Os08g39740-LOC_Os08g39750	intergenic_region ; MODIFIER	silent_mutation	Average:46.596; most accessible tissue: Zhenshan97 root, score: 61.518	N	N	N	N
vg0825168314	G -> DEL	N	N	silent_mutation	Average:46.596; most accessible tissue: Zhenshan97 root, score: 61.518	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0825168314	8.80E-06	NA	mr1111	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825168314	3.05E-06	NA	mr1111	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825168314	6.91E-06	NA	mr1237	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825168314	NA	6.98E-08	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825168314	NA	4.29E-07	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825168314	9.83E-06	NA	mr1874	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825168314	8.14E-06	4.11E-10	mr1874	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825168314	NA	1.80E-12	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825168314	NA	4.30E-09	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825168314	5.57E-10	1.78E-17	mr1874_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825168314	1.33E-09	1.02E-14	mr1874_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251