\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0825168314:

Variant ID: vg0825168314 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 25168314
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


CAGTCTTGTCCGAGTAGAACTCTTTCCATCTCGTAAATTCCGTGAAGGATTTCCTTAATGTGTGCAGAGAATATCCGTATGCGCGTGGGTATGCCATACT[G/A]
ATATGCGACGTATATCGAAGGGTAAAGGGTATACCTAACCCGTAACCCTGACAGTAGCCCCTGACTTCTGCTTAAATGAACTCGTGTAACCATTCGCGAC

Reverse complement sequence

GTCGCGAATGGTTACACGAGTTCATTTAAGCAGAAGTCAGGGGCTACTGTCAGGGTTACGGGTTAGGTATACCCTTTACCCTTCGATATACGTCGCATAT[C/T]
AGTATGGCATACCCACGCGCATACGGATATTCTCTGCACACATTAAGGAAATCCTTCACGGAATTTACGAGATGGAAAGAGTTCTACTCGGACAAGACTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.20% 7.90% 0.30% 0.66% NA
All Indica  2759 85.20% 13.20% 0.51% 1.12% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 69.70% 26.10% 1.34% 2.86% NA
Indica II  465 95.90% 3.90% 0.00% 0.22% NA
Indica III  913 85.40% 13.50% 0.22% 0.88% NA
Indica Intermediate  786 90.30% 8.50% 0.51% 0.64% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0825168314 G -> A LOC_Os08g39750.1 upstream_gene_variant ; 444.0bp to feature; MODIFIER silent_mutation Average:46.596; most accessible tissue: Zhenshan97 root, score: 61.518 N N N N
vg0825168314 G -> A LOC_Os08g39760.1 downstream_gene_variant ; 4486.0bp to feature; MODIFIER silent_mutation Average:46.596; most accessible tissue: Zhenshan97 root, score: 61.518 N N N N
vg0825168314 G -> A LOC_Os08g39740-LOC_Os08g39750 intergenic_region ; MODIFIER silent_mutation Average:46.596; most accessible tissue: Zhenshan97 root, score: 61.518 N N N N
vg0825168314 G -> DEL N N silent_mutation Average:46.596; most accessible tissue: Zhenshan97 root, score: 61.518 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0825168314 8.80E-06 NA mr1111 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825168314 3.05E-06 NA mr1111 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825168314 6.91E-06 NA mr1237 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825168314 NA 6.98E-08 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825168314 NA 4.29E-07 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825168314 9.83E-06 NA mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825168314 8.14E-06 4.11E-10 mr1874 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825168314 NA 1.80E-12 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825168314 NA 4.30E-09 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825168314 5.57E-10 1.78E-17 mr1874_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825168314 1.33E-09 1.02E-14 mr1874_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251