\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0825037085:

Variant ID: vg0825037085 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 25037085
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.89, A: 0.11, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


TGGAGGCCTTCCCGCAGCCTCCGACCCAACAGCTGGATCGCCACATGGAGATTGGTGATGGAAGCCACAGCGTGGAGAGTGAAGTGAAGCAAGCCTATGA[T/A]
GAAAGCAACAAGTTAATTCAGCTAATGGTATCGTGCACGAGTCCCTGCATGTGCATGATGACTCGGCCTGCCGCCACGCCTTGGCTGCGGAAAATTGGTG

Reverse complement sequence

CACCAATTTTCCGCAGCCAAGGCGTGGCGGCAGGCCGAGTCATCATGCACATGCAGGGACTCGTGCACGATACCATTAGCTGAATTAACTTGTTGCTTTC[A/T]
TCATAGGCTTGCTTCACTTCACTCTCCACGCTGTGGCTTCCATCACCAATCTCCATGTGGCGATCCAGCTGTTGGGTCGGAGGCTGCGGGAAGGCCTCCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.30% 23.20% 0.04% 0.42% NA
All Indica  2759 69.60% 29.80% 0.07% 0.62% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 5.90% 93.70% 0.00% 0.37% NA
Indica I  595 65.90% 32.80% 0.00% 1.34% NA
Indica II  465 90.50% 9.20% 0.00% 0.22% NA
Indica III  913 64.10% 35.60% 0.00% 0.33% NA
Indica Intermediate  786 66.30% 32.80% 0.25% 0.64% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 81.10% 16.70% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0825037085 T -> A LOC_Os08g39570.1 missense_variant ; p.Asp782Glu; MODERATE nonsynonymous_codon ; D782E Average:79.921; most accessible tissue: Zhenshan97 panicle, score: 90.661 unknown unknown TOLERATED 1.00
vg0825037085 T -> DEL LOC_Os08g39570.1 N frameshift_variant Average:79.921; most accessible tissue: Zhenshan97 panicle, score: 90.661 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0825037085 T A -0.01 -0.01 -0.01 -0.02 -0.03 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0825037085 NA 7.80E-07 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825037085 9.77E-30 1.13E-53 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825037085 6.74E-29 1.36E-35 mr1874 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825037085 NA 4.65E-06 mr1887 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825037085 NA 2.32E-09 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825037085 8.49E-07 NA mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825037085 1.60E-06 3.20E-07 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825037085 5.35E-31 1.07E-76 mr1874_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825037085 1.21E-30 7.61E-45 mr1874_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251