\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0824984265:

Variant ID: vg0824984265 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 24984265
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


ACTTCGTAAATGAAGTTATGGGTTCTTTTCTCCCCTAAATATTTGAGCAAAAGTACTACCCACATACTCCCTCCCTTCAGAAAAAATAAATTGCTGGCTA[T/C]
GTATAACTAGTAGATGCCCCTCGCATCATAGCAGGACATTAGAACTCCTTTGATAAAAAAAAACATTGATATGATAGTTGATATCTCATAGCCACTTCGA

Reverse complement sequence

TCGAAGTGGCTATGAGATATCAACTATCATATCAATGTTTTTTTTTATCAAAGGAGTTCTAATGTCCTGCTATGATGCGAGGGGCATCTACTAGTTATAC[A/G]
TAGCCAGCAATTTATTTTTTCTGAAGGGAGGGAGTATGTGGGTAGTACTTTTGCTCAAATATTTAGGGGAGAAAAGAACCCATAACTTCATTTACGAAGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.40% 16.50% 0.11% 0.00% NA
All Indica  2759 72.00% 27.80% 0.18% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 67.90% 31.80% 0.34% 0.00% NA
Indica II  465 79.10% 20.90% 0.00% 0.00% NA
Indica III  913 61.60% 38.30% 0.11% 0.00% NA
Indica Intermediate  786 83.00% 16.80% 0.25% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0824984265 T -> C LOC_Os08g39490.1 upstream_gene_variant ; 2610.0bp to feature; MODIFIER silent_mutation Average:52.987; most accessible tissue: Callus, score: 68.503 N N N N
vg0824984265 T -> C LOC_Os08g39490.2 upstream_gene_variant ; 1818.0bp to feature; MODIFIER silent_mutation Average:52.987; most accessible tissue: Callus, score: 68.503 N N N N
vg0824984265 T -> C LOC_Os08g39490.3 upstream_gene_variant ; 2507.0bp to feature; MODIFIER silent_mutation Average:52.987; most accessible tissue: Callus, score: 68.503 N N N N
vg0824984265 T -> C LOC_Os08g39480-LOC_Os08g39490 intergenic_region ; MODIFIER silent_mutation Average:52.987; most accessible tissue: Callus, score: 68.503 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0824984265 7.18E-10 1.35E-16 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824984265 1.23E-09 8.91E-15 mr1874 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824984265 6.02E-13 1.36E-18 mr1874_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824984265 2.62E-12 2.44E-17 mr1874_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251