Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0824901602:

Variant ID: vg0824901602 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 24901602
Reference Allele: G	Alternative Allele: C,T
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

TAGTAAGCAACTATTGTATGGATTGACTATAAATGAATTGGAGCCAGTAGTGGGCTATACTATTAAATTTGCTCTAATAGTGATAGTACATCGTTGAAAG[G/C,T]
TAGAGGGGGATCAGGAAATTAAAAGTGGCATTGAACTTGTAGGGTGAGACCAGGAAACTAAAAGAGGCATTGAACTTGCAGGGTGTCTAGTACGAAAGTG

Reverse complement sequence

CACTTTCGTACTAGACACCCTGCAAGTTCAATGCCTCTTTTAGTTTCCTGGTCTCACCCTACAAGTTCAATGCCACTTTTAATTTCCTGATCCCCCTCTA[C/G,A]
CTTTCAACGATGTACTATCACTATTAGAGCAAATTTAATAGTATAGCCCACTACTGGCTCCAATTCATTTATAGTCAATCCATACAATAGTTGCTTACTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.10%	10.20%	2.60%	0.00%	T: 0.04%
All Indica	2759	96.70%	0.80%	2.43%	0.00%	T: 0.07%
All Japonica	1512	67.50%	29.10%	3.37%	0.00%	NA
Aus	269	96.30%	3.00%	0.74%	0.00%	NA
Indica I	595	92.40%	1.50%	6.05%	0.00%	NA
Indica II	465	97.40%	0.40%	2.15%	0.00%	NA
Indica III	913	99.60%	0.40%	0.00%	0.00%	NA
Indica Intermediate	786	96.10%	1.00%	2.67%	0.00%	T: 0.25%
Temperate Japonica	767	40.40%	53.50%	6.13%	0.00%	NA
Tropical Japonica	504	98.40%	1.20%	0.40%	0.00%	NA
Japonica Intermediate	241	89.20%	10.00%	0.83%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	82.20%	14.40%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0824901602	G -> C	LOC_Os08g39390.1	upstream_gene_variant ; 3697.0bp to feature; MODIFIER	silent_mutation	Average:59.321; most accessible tissue: Callus, score: 91.56	N	N	N	N
vg0824901602	G -> C	LOC_Os08g39380-LOC_Os08g39390	intergenic_region ; MODIFIER	silent_mutation	Average:59.321; most accessible tissue: Callus, score: 91.56	N	N	N	N
vg0824901602	G -> T	LOC_Os08g39390.1	upstream_gene_variant ; 3697.0bp to feature; MODIFIER	silent_mutation	Average:59.321; most accessible tissue: Callus, score: 91.56	N	N	N	N
vg0824901602	G -> T	LOC_Os08g39380-LOC_Os08g39390	intergenic_region ; MODIFIER	silent_mutation	Average:59.321; most accessible tissue: Callus, score: 91.56	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0824901602	NA	5.48E-15	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0824901602	NA	3.49E-18	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0824901602	NA	2.08E-13	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0824901602	NA	6.34E-06	mr1026	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824901602	NA	1.13E-06	mr1072	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824901602	NA	1.52E-10	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824901602	1.30E-06	1.18E-23	mr1163	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824901602	NA	1.53E-10	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824901602	NA	5.68E-06	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824901602	NA	1.40E-08	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824901602	NA	2.37E-07	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824901602	NA	6.83E-07	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824901602	NA	1.08E-07	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824901602	NA	6.37E-06	mr1271	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824901602	NA	2.13E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824901602	NA	6.47E-11	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824901602	NA	1.91E-08	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824901602	NA	1.86E-07	mr1530	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824901602	NA	7.42E-07	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824901602	NA	1.27E-07	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824901602	NA	1.20E-09	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824901602	NA	1.44E-06	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824901602	NA	5.58E-09	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824901602	NA	1.24E-06	mr1748	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824901602	NA	1.76E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824901602	NA	7.72E-06	mr1794	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824901602	NA	3.39E-08	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824901602	NA	3.04E-09	mr1880	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824901602	NA	2.86E-09	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824901602	NA	1.50E-08	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824901602	NA	8.29E-10	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824901602	NA	6.85E-08	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824901602	NA	9.00E-14	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824901602	NA	2.33E-07	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824901602	NA	4.27E-11	mr1530_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824901602	NA	6.30E-07	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251