\
| Variant ID: vg0824769690 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 24769690 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 300. )
ACCAACTGCCAGCTATGTAGATGCCATTACCACCAGTCTCATTACTAAAAAAAATCTACATATAGAGTTGATGGCATGAGTACAAGGTAATTAGGGAGTG[A/G]
TTGTCACCTTGAGAGGAATTCTTTATCTTGATGCATCCCCCTTCCATCAAGGGATTGCCGTAAGTCCCATCAGGACAGCGGCAATGAAATGTTCCGGGCA
TGCCCGGAACATTTCATTGCCGCTGTCCTGATGGGACTTACGGCAATCCCTTGATGGAAGGGGGATGCATCAAGATAAAGAATTCCTCTCAAGGTGACAA[T/C]
CACTCCCTAATTACCTTGTACTCATGCCATCAACTCTATATGTAGATTTTTTTTAGTAATGAGACTGGTGGTAATGGCATCTACATAGCTGGCAGTTGGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.90% | 13.00% | 1.10% | 0.00% | NA |
| All Indica | 2759 | 76.60% | 21.60% | 1.85% | 0.00% | NA |
| All Japonica | 1512 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 64.70% | 29.20% | 6.05% | 0.00% | NA |
| Indica II | 465 | 48.60% | 50.10% | 1.29% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 74.90% | 23.90% | 1.15% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 15.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0824769690 | A -> G | LOC_Os08g39220.1 | upstream_gene_variant ; 3271.0bp to feature; MODIFIER | silent_mutation | Average:45.783; most accessible tissue: Callus, score: 81.316 | N | N | N | N |
| vg0824769690 | A -> G | LOC_Os08g39210.1 | intron_variant ; MODIFIER | silent_mutation | Average:45.783; most accessible tissue: Callus, score: 81.316 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0824769690 | NA | 3.19E-06 | mr1212 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824769690 | 5.06E-06 | 6.55E-08 | mr1699 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824769690 | NA | 1.41E-06 | mr1727 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824769690 | NA | 7.01E-06 | mr1874 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824769690 | 1.74E-06 | NA | mr1699_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824769690 | 1.24E-06 | 4.30E-10 | mr1699_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824769690 | NA | 5.25E-10 | mr1874_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |