| Variant ID: vg0824722894 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 24722894 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 291. )
ACAACATTTAAACATCAACACTCAAAGCATGTGAGACTTTTCAGATGCGACTTTATCAGAGCAATCGTAAATAATGCTACGAGATTAATTAGCAGAACAA[C/T]
GACAGATAATGCTGCCTATGCCTGCAGTTATGTTTATAACATTCTAATCAGCAGCAAAATTCAGGACTCTTAACAAAATTAAGGACCGCATGATCCACAG
CTGTGGATCATGCGGTCCTTAATTTTGTTAAGAGTCCTGAATTTTGCTGCTGATTAGAATGTTATAAACATAACTGCAGGCATAGGCAGCATTATCTGTC[G/A]
TTGTTCTGCTAATTAATCTCGTAGCATTATTTACGATTGCTCTGATAAAGTCGCATCTGAAAAGTCTCACATGCTTTGAGTGTTGATGTTTAAATGTTGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.20% | 11.00% | 1.78% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.10% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 62.40% | 32.90% | 4.76% | 0.00% | NA |
| Aus | 269 | 95.90% | 2.60% | 1.49% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.20% | 0.50% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.30% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 30.40% | 61.10% | 8.47% | 0.00% | NA |
| Tropical Japonica | 504 | 97.80% | 1.20% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.00% | 9.10% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 12.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0824722894 | C -> T | LOC_Os08g39140.3 | 5_prime_UTR_variant ; 772.0bp to feature; MODIFIER | silent_mutation | Average:45.36; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 | N | N | N | N |
| vg0824722894 | C -> T | LOC_Os08g39150.1 | upstream_gene_variant ; 4051.0bp to feature; MODIFIER | silent_mutation | Average:45.36; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 | N | N | N | N |
| vg0824722894 | C -> T | LOC_Os08g39130.1 | downstream_gene_variant ; 4584.0bp to feature; MODIFIER | silent_mutation | Average:45.36; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 | N | N | N | N |
| vg0824722894 | C -> T | LOC_Os08g39140.1 | intron_variant ; MODIFIER | silent_mutation | Average:45.36; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 | N | N | N | N |
| vg0824722894 | C -> T | LOC_Os08g39140.2 | intron_variant ; MODIFIER | silent_mutation | Average:45.36; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 | N | N | N | N |
| vg0824722894 | C -> T | LOC_Os08g39140.4 | intron_variant ; MODIFIER | silent_mutation | Average:45.36; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0824722894 | NA | 1.91E-14 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0824722894 | NA | 6.00E-18 | Spikelet_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0824722894 | NA | 2.11E-12 | Spikelet_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0824722894 | NA | 9.95E-08 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824722894 | NA | 1.41E-06 | mr1072 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824722894 | NA | 8.51E-06 | mr1075 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824722894 | NA | 1.37E-06 | mr1077 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824722894 | NA | 8.61E-12 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824722894 | NA | 1.12E-06 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824722894 | NA | 1.19E-06 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/