Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0824571069:

Variant ID: vg0824571069 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 24571069
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.21, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

CGCGGTTATCACGGTAAACCATGCGATTATCGTGGTGAAACCGCGAAACCACCGAGTTTTGAATTCGAATTTTTGGATGTGATTTTTGTGCGATTTTAGA[C/T]
GATTATCACGCGATTATCGTGGTTATCGCGCTACTGCGGGGGTGGCGGTAATCTCGGCCCAAACGATAAGGTAAACCCTGGGTCCAACAAATGTGTTCTC

Reverse complement sequence

GAGAACACATTTGTTGGACCCAGGGTTTACCTTATCGTTTGGGCCGAGATTACCGCCACCCCCGCAGTAGCGCGATAACCACGATAATCGCGTGATAATC[G/A]
TCTAAAATCGCACAAAAATCACATCCAAAAATTCGAATTCAAAACTCGGTGGTTTCGCGGTTTCACCACGATAATCGCATGGTTTACCGTGATAACCGCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.70%	12.80%	0.51%	0.00%	NA
All Indica	2759	77.90%	21.30%	0.80%	0.00%	NA
All Japonica	1512	99.80%	0.20%	0.00%	0.00%	NA
Aus	269	97.80%	1.50%	0.74%	0.00%	NA
Indica I	595	95.60%	4.40%	0.00%	0.00%	NA
Indica II	465	83.70%	15.50%	0.86%	0.00%	NA
Indica III	913	59.50%	39.50%	0.99%	0.00%	NA
Indica Intermediate	786	82.40%	16.40%	1.15%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	10.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0824571069	C -> T	LOC_Os08g38860.1	upstream_gene_variant ; 3011.0bp to feature; MODIFIER	silent_mutation	Average:63.007; most accessible tissue: Minghui63 flag leaf, score: 80.786	N	N	N	N
vg0824571069	C -> T	LOC_Os08g38880.1	upstream_gene_variant ; 4493.0bp to feature; MODIFIER	silent_mutation	Average:63.007; most accessible tissue: Minghui63 flag leaf, score: 80.786	N	N	N	N
vg0824571069	C -> T	LOC_Os08g38880.2	upstream_gene_variant ; 4493.0bp to feature; MODIFIER	silent_mutation	Average:63.007; most accessible tissue: Minghui63 flag leaf, score: 80.786	N	N	N	N
vg0824571069	C -> T	LOC_Os08g38880.4	upstream_gene_variant ; 4570.0bp to feature; MODIFIER	silent_mutation	Average:63.007; most accessible tissue: Minghui63 flag leaf, score: 80.786	N	N	N	N
vg0824571069	C -> T	LOC_Os08g38880.5	upstream_gene_variant ; 4570.0bp to feature; MODIFIER	silent_mutation	Average:63.007; most accessible tissue: Minghui63 flag leaf, score: 80.786	N	N	N	N
vg0824571069	C -> T	LOC_Os08g38850.1	downstream_gene_variant ; 4957.0bp to feature; MODIFIER	silent_mutation	Average:63.007; most accessible tissue: Minghui63 flag leaf, score: 80.786	N	N	N	N
vg0824571069	C -> T	LOC_Os08g38870.1	downstream_gene_variant ; 2321.0bp to feature; MODIFIER	silent_mutation	Average:63.007; most accessible tissue: Minghui63 flag leaf, score: 80.786	N	N	N	N
vg0824571069	C -> T	LOC_Os08g38850.2	downstream_gene_variant ; 4980.0bp to feature; MODIFIER	silent_mutation	Average:63.007; most accessible tissue: Minghui63 flag leaf, score: 80.786	N	N	N	N
vg0824571069	C -> T	LOC_Os08g38870-LOC_Os08g38880	intergenic_region ; MODIFIER	silent_mutation	Average:63.007; most accessible tissue: Minghui63 flag leaf, score: 80.786	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0824571069	1.42E-06	3.10E-06	mr1559	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251