\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0824571069:

Variant ID: vg0824571069 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 24571069
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.21, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


CGCGGTTATCACGGTAAACCATGCGATTATCGTGGTGAAACCGCGAAACCACCGAGTTTTGAATTCGAATTTTTGGATGTGATTTTTGTGCGATTTTAGA[C/T]
GATTATCACGCGATTATCGTGGTTATCGCGCTACTGCGGGGGTGGCGGTAATCTCGGCCCAAACGATAAGGTAAACCCTGGGTCCAACAAATGTGTTCTC

Reverse complement sequence

GAGAACACATTTGTTGGACCCAGGGTTTACCTTATCGTTTGGGCCGAGATTACCGCCACCCCCGCAGTAGCGCGATAACCACGATAATCGCGTGATAATC[G/A]
TCTAAAATCGCACAAAAATCACATCCAAAAATTCGAATTCAAAACTCGGTGGTTTCGCGGTTTCACCACGATAATCGCATGGTTTACCGTGATAACCGCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.70% 12.80% 0.51% 0.00% NA
All Indica  2759 77.90% 21.30% 0.80% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 97.80% 1.50% 0.74% 0.00% NA
Indica I  595 95.60% 4.40% 0.00% 0.00% NA
Indica II  465 83.70% 15.50% 0.86% 0.00% NA
Indica III  913 59.50% 39.50% 0.99% 0.00% NA
Indica Intermediate  786 82.40% 16.40% 1.15% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0824571069 C -> T LOC_Os08g38860.1 upstream_gene_variant ; 3011.0bp to feature; MODIFIER silent_mutation Average:63.007; most accessible tissue: Minghui63 flag leaf, score: 80.786 N N N N
vg0824571069 C -> T LOC_Os08g38880.1 upstream_gene_variant ; 4493.0bp to feature; MODIFIER silent_mutation Average:63.007; most accessible tissue: Minghui63 flag leaf, score: 80.786 N N N N
vg0824571069 C -> T LOC_Os08g38880.2 upstream_gene_variant ; 4493.0bp to feature; MODIFIER silent_mutation Average:63.007; most accessible tissue: Minghui63 flag leaf, score: 80.786 N N N N
vg0824571069 C -> T LOC_Os08g38880.4 upstream_gene_variant ; 4570.0bp to feature; MODIFIER silent_mutation Average:63.007; most accessible tissue: Minghui63 flag leaf, score: 80.786 N N N N
vg0824571069 C -> T LOC_Os08g38880.5 upstream_gene_variant ; 4570.0bp to feature; MODIFIER silent_mutation Average:63.007; most accessible tissue: Minghui63 flag leaf, score: 80.786 N N N N
vg0824571069 C -> T LOC_Os08g38850.1 downstream_gene_variant ; 4957.0bp to feature; MODIFIER silent_mutation Average:63.007; most accessible tissue: Minghui63 flag leaf, score: 80.786 N N N N
vg0824571069 C -> T LOC_Os08g38870.1 downstream_gene_variant ; 2321.0bp to feature; MODIFIER silent_mutation Average:63.007; most accessible tissue: Minghui63 flag leaf, score: 80.786 N N N N
vg0824571069 C -> T LOC_Os08g38850.2 downstream_gene_variant ; 4980.0bp to feature; MODIFIER silent_mutation Average:63.007; most accessible tissue: Minghui63 flag leaf, score: 80.786 N N N N
vg0824571069 C -> T LOC_Os08g38870-LOC_Os08g38880 intergenic_region ; MODIFIER silent_mutation Average:63.007; most accessible tissue: Minghui63 flag leaf, score: 80.786 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0824571069 1.42E-06 3.10E-06 mr1559 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251