\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0824561001:

Variant ID: vg0824561001 (JBrowse)Variation Type: INDEL
Chromosome: chr08Position: 24561001
Reference Allele: GAGATAlternative Allele: TAGAT,G,GATAGAT
Primary Allele: GAGATSecondary Allele: TAGAT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAACCCCTCCAGTTGCCCACCAGAAGGAGCAAACAGAGAGAGGCAGAAGGCAAGCTGCAGTGTTGGGGGAGAAGAAAGGAGAGAGAGAGAGAGAGAGAGA[GAGAT/TAGAT,G,GATAGAT]
AGAGAGAGAGAGAGGCAGTGGCAGAGGCAGAGGAAGGGAAAGAAAGCTCCAATCTCGCCTCTGCTCCTGTCTCCAGGAAATCTTGATGCTTGCACATAAA

Reverse complement sequence

TTTATGTGCAAGCATCAAGATTTCCTGGAGACAGGAGCAGAGGCGAGATTGGAGCTTTCTTTCCCTTCCTCTGCCTCTGCCACTGCCTCTCTCTCTCTCT[ATCTC/ATCTA,C,ATCTATC]
TCTCTCTCTCTCTCTCTCTCTCCTTTCTTCTCCCCCAACACTGCAGCTTGCCTTCTGCCTCTCTCTGTTTGCTCCTTCTGGTGGGCAACTGGAGGGGTTG

Allele Frequencies:

Populations Population SizeFrequency of GAGAT(primary allele) Frequency of TAGAT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.30% 10.40% 1.57% 1.21% G: 0.44%; GATAGAT: 0.06%
All Indica  2759 91.70% 5.70% 1.27% 0.58% G: 0.65%; GATAGAT: 0.07%
All Japonica  1512 89.70% 8.60% 0.86% 0.53% G: 0.20%; GATAGAT: 0.07%
Aus  269 11.50% 70.30% 7.81% 10.41% NA
Indica I  595 97.00% 0.50% 2.18% 0.34% NA
Indica II  465 89.50% 8.20% 1.29% 0.43% G: 0.65%
Indica III  913 91.60% 5.80% 0.66% 0.66% G: 1.20%; GATAGAT: 0.11%
Indica Intermediate  786 89.20% 8.10% 1.27% 0.76% G: 0.51%; GATAGAT: 0.13%
Temperate Japonica  767 96.70% 2.60% 0.52% 0.13% NA
Tropical Japonica  504 77.60% 19.60% 0.79% 1.39% G: 0.40%; GATAGAT: 0.20%
Japonica Intermediate  241 92.90% 4.60% 2.07% 0.00% G: 0.41%
VI/Aromatic  96 83.30% 11.50% 2.08% 3.12% NA
Intermediate  90 88.90% 5.60% 3.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0824561001 GAGAT -> TAGAT LOC_Os08g38850.1 5_prime_UTR_variant ; 666.0bp to feature; MODIFIER silent_mutation Average:86.987; most accessible tissue: Zhenshan97 panicle, score: 99.283 N N N N
vg0824561001 GAGAT -> TAGAT LOC_Os08g38850.2 upstream_gene_variant ; 490.0bp to feature; MODIFIER silent_mutation Average:86.987; most accessible tissue: Zhenshan97 panicle, score: 99.283 N N N N
vg0824561001 GAGAT -> GATAGAT LOC_Os08g38850.1 5_prime_UTR_variant ; 664.0bp to feature; MODIFIER silent_mutation Average:86.987; most accessible tissue: Zhenshan97 panicle, score: 99.283 N N N N
vg0824561001 GAGAT -> GATAGAT LOC_Os08g38850.2 upstream_gene_variant ; 488.0bp to feature; MODIFIER silent_mutation Average:86.987; most accessible tissue: Zhenshan97 panicle, score: 99.283 N N N N
vg0824561001 GAGAT -> G LOC_Os08g38850.1 5_prime_UTR_variant ; 659.0bp to feature; MODIFIER silent_mutation Average:86.987; most accessible tissue: Zhenshan97 panicle, score: 99.283 N N N N
vg0824561001 GAGAT -> G LOC_Os08g38850.2 upstream_gene_variant ; 489.0bp to feature; MODIFIER silent_mutation Average:86.987; most accessible tissue: Zhenshan97 panicle, score: 99.283 N N N N
vg0824561001 GAGAT -> DEL N N silent_mutation Average:86.987; most accessible tissue: Zhenshan97 panicle, score: 99.283 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0824561001 GAGAT G 0.07 0.08 0.05 -0.12 -0.01 0.1
vg0824561001 GAGAT GATAG* -0.08 0.09 0.1 -0.08 -0.08 0.04
vg0824561001 GAGAT TAGAT -0.04 -0.03 -0.02 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0824561001 NA 5.71E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824561001 2.11E-06 3.39E-06 mr1296 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824561001 6.53E-06 3.95E-07 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824561001 2.31E-06 2.31E-06 mr1479 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824561001 NA 2.55E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824561001 7.92E-07 9.48E-08 mr1892 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824561001 NA 3.63E-06 mr1218_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824561001 1.48E-06 1.41E-07 mr1830_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251