\
| Variant ID: vg0824560196 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 24560196 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TCTCTCTCTATAGATCTCAATAGAGCTTAATCTGTAGAGATTAAATTTCTATATTTTTTTTCGATATATTTTGTAGTGGATGTGGTTTTGTTTCTGGATG[C/G]
TTAGATAGGTTGAGCTCCTATATTTTTATCAGATCTGATCCATGTACAAGTGGTACATGTTATACTAATATATTGATCAGATATTGTAAACAATCAATAA
TTATTGATTGTTTACAATATCTGATCAATATATTAGTATAACATGTACCACTTGTACATGGATCAGATCTGATAAAAATATAGGAGCTCAACCTATCTAA[G/C]
CATCCAGAAACAAAACCACATCCACTACAAAATATATCGAAAAAAAATATAGAAATTTAATCTCTACAGATTAAGCTCTATTGAGATCTATAGAGAGAGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.60% | 4.50% | 0.89% | 0.00% | NA |
| All Indica | 2759 | 90.80% | 7.70% | 1.49% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 68.70% | 26.70% | 4.54% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.40% | 0.43% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.80% | 4.70% | 1.53% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0824560196 | C -> G | LOC_Os08g38850.1 | upstream_gene_variant ; 697.0bp to feature; MODIFIER | silent_mutation | Average:55.331; most accessible tissue: Callus, score: 82.538 | N | N | N | N |
| vg0824560196 | C -> G | LOC_Os08g38850.2 | upstream_gene_variant ; 1295.0bp to feature; MODIFIER | silent_mutation | Average:55.331; most accessible tissue: Callus, score: 82.538 | N | N | N | N |
| vg0824560196 | C -> G | LOC_Os08g38840-LOC_Os08g38850 | intergenic_region ; MODIFIER | silent_mutation | Average:55.331; most accessible tissue: Callus, score: 82.538 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0824560196 | NA | 1.90E-06 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824560196 | NA | 5.99E-08 | mr1874 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824560196 | 1.42E-06 | NA | mr1874_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824560196 | 3.85E-06 | 3.91E-09 | mr1874_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |