\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0824560196:

Variant ID: vg0824560196 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 24560196
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTCTCTCTATAGATCTCAATAGAGCTTAATCTGTAGAGATTAAATTTCTATATTTTTTTTCGATATATTTTGTAGTGGATGTGGTTTTGTTTCTGGATG[C/G]
TTAGATAGGTTGAGCTCCTATATTTTTATCAGATCTGATCCATGTACAAGTGGTACATGTTATACTAATATATTGATCAGATATTGTAAACAATCAATAA

Reverse complement sequence

TTATTGATTGTTTACAATATCTGATCAATATATTAGTATAACATGTACCACTTGTACATGGATCAGATCTGATAAAAATATAGGAGCTCAACCTATCTAA[G/C]
CATCCAGAAACAAAACCACATCCACTACAAAATATATCGAAAAAAAATATAGAAATTTAATCTCTACAGATTAAGCTCTATTGAGATCTATAGAGAGAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.60% 4.50% 0.89% 0.00% NA
All Indica  2759 90.80% 7.70% 1.49% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 68.70% 26.70% 4.54% 0.00% NA
Indica II  465 97.20% 2.40% 0.43% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 93.80% 4.70% 1.53% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 1.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0824560196 C -> G LOC_Os08g38850.1 upstream_gene_variant ; 697.0bp to feature; MODIFIER silent_mutation Average:55.331; most accessible tissue: Callus, score: 82.538 N N N N
vg0824560196 C -> G LOC_Os08g38850.2 upstream_gene_variant ; 1295.0bp to feature; MODIFIER silent_mutation Average:55.331; most accessible tissue: Callus, score: 82.538 N N N N
vg0824560196 C -> G LOC_Os08g38840-LOC_Os08g38850 intergenic_region ; MODIFIER silent_mutation Average:55.331; most accessible tissue: Callus, score: 82.538 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0824560196 NA 1.90E-06 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824560196 NA 5.99E-08 mr1874 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824560196 1.42E-06 NA mr1874_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824560196 3.85E-06 3.91E-09 mr1874_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251