\
| Variant ID: vg0824546058 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 24546058 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCTTTAAATCATAGGAATGAAAAAACAGAGGAATAGGAAAAATATAGGATTCTGATAGGAATACAAGTGTAAAACAGAGGAATGCAAAACACAGGAAAAA[C/T]
ATAGAAATGACCGTTTGATTGAGCCGCAGGAAAAACACAGGAATTTGATAAGAGATAAAGACTCAGGGCTTATTCGGAATGCAGGATTGAAAAAATATAG
CTATATTTTTTCAATCCTGCATTCCGAATAAGCCCTGAGTCTTTATCTCTTATCAAATTCCTGTGTTTTTCCTGCGGCTCAATCAAACGGTCATTTCTAT[G/A]
TTTTTCCTGTGTTTTGCATTCCTCTGTTTTACACTTGTATTCCTATCAGAATCCTATATTTTTCCTATTCCTCTGTTTTTTCATTCCTATGATTTAAAGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.10% | 1.70% | 1.18% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 91.10% | 5.20% | 3.64% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 84.00% | 9.40% | 6.65% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.90% | 2.90% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0824546058 | C -> T | LOC_Os08g38820.1 | upstream_gene_variant ; 3885.0bp to feature; MODIFIER | silent_mutation | Average:29.848; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0824546058 | C -> T | LOC_Os08g38840.1 | upstream_gene_variant ; 1958.0bp to feature; MODIFIER | silent_mutation | Average:29.848; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0824546058 | C -> T | LOC_Os08g38820.2 | upstream_gene_variant ; 3885.0bp to feature; MODIFIER | silent_mutation | Average:29.848; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0824546058 | C -> T | LOC_Os08g38830.1 | downstream_gene_variant ; 927.0bp to feature; MODIFIER | silent_mutation | Average:29.848; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0824546058 | C -> T | LOC_Os08g38830-LOC_Os08g38840 | intergenic_region ; MODIFIER | silent_mutation | Average:29.848; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0824546058 | NA | 2.45E-07 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824546058 | 3.08E-06 | 3.08E-06 | mr1430_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824546058 | NA | 3.38E-07 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824546058 | NA | 4.90E-08 | mr1765_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |