\
| Variant ID: vg0824413447 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr08 | Position: 24413447 |
| Reference Allele: T | Alternative Allele: C,TAAGCATTTTATC |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTCAAAGGTTGTTTGCTCAAGATCAGAAAGATGGAAACTCAAAAGTGAATAGTGTACCTGTCTAGTTGAAATATATTGTGCGTGCAAATAAGCATTTTAT[T/C,TAAGCATTTTATC]
AAACAGGGGAAAACATTGTTCTGATAAATTTACCTCAGAATTGATTAACTCGGTTCAGCTGTTTGGGGAGCAGACAACCAGGGCTGGTACTAACTTCTTG
CAAGAAGTTAGTACCAGCCCTGGTTGTCTGCTCCCCAAACAGCTGAACCGAGTTAATCAATTCTGAGGTAAATTTATCAGAACAATGTTTTCCCCTGTTT[A/G,GATAAAATGCTTA]
ATAAAATGCTTATTTGCACGCACAATATATTTCAACTAGACAGGTACACTATTCACTTTTGAGTTTCCATCTTTCTGATCTTGAGCAAACAACCTTTGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.00% | 8.90% | 8.06% | 0.00% | TAAGCATTTTATC: 0.02% |
| All Indica | 2759 | 92.20% | 0.70% | 7.10% | 0.00% | NA |
| All Japonica | 1512 | 62.90% | 25.80% | 11.24% | 0.00% | TAAGCATTTTATC: 0.07% |
| Aus | 269 | 97.40% | 0.00% | 2.60% | 0.00% | NA |
| Indica I | 595 | 79.80% | 1.30% | 18.82% | 0.00% | NA |
| Indica II | 465 | 93.30% | 0.60% | 6.02% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 92.20% | 0.90% | 6.87% | 0.00% | NA |
| Temperate Japonica | 767 | 34.60% | 46.90% | 18.51% | 0.00% | NA |
| Tropical Japonica | 504 | 95.40% | 2.20% | 2.18% | 0.00% | TAAGCATTTTATC: 0.20% |
| Japonica Intermediate | 241 | 85.10% | 7.90% | 7.05% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 14.40% | 8.89% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0824413447 | T -> TAAGCATTTTATC | LOC_Os08g38630.1 | upstream_gene_variant ; 831.0bp to feature; MODIFIER | silent_mutation | Average:71.036; most accessible tissue: Callus, score: 84.299 | N | N | N | N |
| vg0824413447 | T -> TAAGCATTTTATC | LOC_Os08g38640.1 | upstream_gene_variant ; 2981.0bp to feature; MODIFIER | silent_mutation | Average:71.036; most accessible tissue: Callus, score: 84.299 | N | N | N | N |
| vg0824413447 | T -> TAAGCATTTTATC | LOC_Os08g38620.1 | downstream_gene_variant ; 630.0bp to feature; MODIFIER | silent_mutation | Average:71.036; most accessible tissue: Callus, score: 84.299 | N | N | N | N |
| vg0824413447 | T -> TAAGCATTTTATC | LOC_Os08g38620.2 | downstream_gene_variant ; 630.0bp to feature; MODIFIER | silent_mutation | Average:71.036; most accessible tissue: Callus, score: 84.299 | N | N | N | N |
| vg0824413447 | T -> TAAGCATTTTATC | LOC_Os08g38620.3 | downstream_gene_variant ; 630.0bp to feature; MODIFIER | silent_mutation | Average:71.036; most accessible tissue: Callus, score: 84.299 | N | N | N | N |
| vg0824413447 | T -> TAAGCATTTTATC | LOC_Os08g38620-LOC_Os08g38630 | intergenic_region ; MODIFIER | silent_mutation | Average:71.036; most accessible tissue: Callus, score: 84.299 | N | N | N | N |
| vg0824413447 | T -> C | LOC_Os08g38630.1 | upstream_gene_variant ; 832.0bp to feature; MODIFIER | silent_mutation | Average:71.036; most accessible tissue: Callus, score: 84.299 | N | N | N | N |
| vg0824413447 | T -> C | LOC_Os08g38640.1 | upstream_gene_variant ; 2982.0bp to feature; MODIFIER | silent_mutation | Average:71.036; most accessible tissue: Callus, score: 84.299 | N | N | N | N |
| vg0824413447 | T -> C | LOC_Os08g38620.1 | downstream_gene_variant ; 629.0bp to feature; MODIFIER | silent_mutation | Average:71.036; most accessible tissue: Callus, score: 84.299 | N | N | N | N |
| vg0824413447 | T -> C | LOC_Os08g38620.2 | downstream_gene_variant ; 629.0bp to feature; MODIFIER | silent_mutation | Average:71.036; most accessible tissue: Callus, score: 84.299 | N | N | N | N |
| vg0824413447 | T -> C | LOC_Os08g38620.3 | downstream_gene_variant ; 629.0bp to feature; MODIFIER | silent_mutation | Average:71.036; most accessible tissue: Callus, score: 84.299 | N | N | N | N |
| vg0824413447 | T -> C | LOC_Os08g38620-LOC_Os08g38630 | intergenic_region ; MODIFIER | silent_mutation | Average:71.036; most accessible tissue: Callus, score: 84.299 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0824413447 | NA | 2.11E-09 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824413447 | NA | 6.10E-09 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824413447 | NA | 9.71E-07 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824413447 | NA | 4.34E-07 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824413447 | 1.25E-06 | 9.56E-08 | mr1955 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824413447 | NA | 7.64E-08 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824413447 | NA | 8.85E-13 | mr1182_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824413447 | NA | 3.23E-07 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824413447 | NA | 1.13E-09 | mr1530_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824413447 | NA | 5.05E-06 | mr1627_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |