\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0824413447:

Variant ID: vg0824413447 (JBrowse)Variation Type: INDEL
Chromosome: chr08Position: 24413447
Reference Allele: TAlternative Allele: C,TAAGCATTTTATC
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCAAAGGTTGTTTGCTCAAGATCAGAAAGATGGAAACTCAAAAGTGAATAGTGTACCTGTCTAGTTGAAATATATTGTGCGTGCAAATAAGCATTTTAT[T/C,TAAGCATTTTATC]
AAACAGGGGAAAACATTGTTCTGATAAATTTACCTCAGAATTGATTAACTCGGTTCAGCTGTTTGGGGAGCAGACAACCAGGGCTGGTACTAACTTCTTG

Reverse complement sequence

CAAGAAGTTAGTACCAGCCCTGGTTGTCTGCTCCCCAAACAGCTGAACCGAGTTAATCAATTCTGAGGTAAATTTATCAGAACAATGTTTTCCCCTGTTT[A/G,GATAAAATGCTTA]
ATAAAATGCTTATTTGCACGCACAATATATTTCAACTAGACAGGTACACTATTCACTTTTGAGTTTCCATCTTTCTGATCTTGAGCAAACAACCTTTGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.00% 8.90% 8.06% 0.00% TAAGCATTTTATC: 0.02%
All Indica  2759 92.20% 0.70% 7.10% 0.00% NA
All Japonica  1512 62.90% 25.80% 11.24% 0.00% TAAGCATTTTATC: 0.07%
Aus  269 97.40% 0.00% 2.60% 0.00% NA
Indica I  595 79.80% 1.30% 18.82% 0.00% NA
Indica II  465 93.30% 0.60% 6.02% 0.00% NA
Indica III  913 99.80% 0.00% 0.22% 0.00% NA
Indica Intermediate  786 92.20% 0.90% 6.87% 0.00% NA
Temperate Japonica  767 34.60% 46.90% 18.51% 0.00% NA
Tropical Japonica  504 95.40% 2.20% 2.18% 0.00% TAAGCATTTTATC: 0.20%
Japonica Intermediate  241 85.10% 7.90% 7.05% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 76.70% 14.40% 8.89% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0824413447 T -> TAAGCATTTTATC LOC_Os08g38630.1 upstream_gene_variant ; 831.0bp to feature; MODIFIER silent_mutation Average:71.036; most accessible tissue: Callus, score: 84.299 N N N N
vg0824413447 T -> TAAGCATTTTATC LOC_Os08g38640.1 upstream_gene_variant ; 2981.0bp to feature; MODIFIER silent_mutation Average:71.036; most accessible tissue: Callus, score: 84.299 N N N N
vg0824413447 T -> TAAGCATTTTATC LOC_Os08g38620.1 downstream_gene_variant ; 630.0bp to feature; MODIFIER silent_mutation Average:71.036; most accessible tissue: Callus, score: 84.299 N N N N
vg0824413447 T -> TAAGCATTTTATC LOC_Os08g38620.2 downstream_gene_variant ; 630.0bp to feature; MODIFIER silent_mutation Average:71.036; most accessible tissue: Callus, score: 84.299 N N N N
vg0824413447 T -> TAAGCATTTTATC LOC_Os08g38620.3 downstream_gene_variant ; 630.0bp to feature; MODIFIER silent_mutation Average:71.036; most accessible tissue: Callus, score: 84.299 N N N N
vg0824413447 T -> TAAGCATTTTATC LOC_Os08g38620-LOC_Os08g38630 intergenic_region ; MODIFIER silent_mutation Average:71.036; most accessible tissue: Callus, score: 84.299 N N N N
vg0824413447 T -> C LOC_Os08g38630.1 upstream_gene_variant ; 832.0bp to feature; MODIFIER silent_mutation Average:71.036; most accessible tissue: Callus, score: 84.299 N N N N
vg0824413447 T -> C LOC_Os08g38640.1 upstream_gene_variant ; 2982.0bp to feature; MODIFIER silent_mutation Average:71.036; most accessible tissue: Callus, score: 84.299 N N N N
vg0824413447 T -> C LOC_Os08g38620.1 downstream_gene_variant ; 629.0bp to feature; MODIFIER silent_mutation Average:71.036; most accessible tissue: Callus, score: 84.299 N N N N
vg0824413447 T -> C LOC_Os08g38620.2 downstream_gene_variant ; 629.0bp to feature; MODIFIER silent_mutation Average:71.036; most accessible tissue: Callus, score: 84.299 N N N N
vg0824413447 T -> C LOC_Os08g38620.3 downstream_gene_variant ; 629.0bp to feature; MODIFIER silent_mutation Average:71.036; most accessible tissue: Callus, score: 84.299 N N N N
vg0824413447 T -> C LOC_Os08g38620-LOC_Os08g38630 intergenic_region ; MODIFIER silent_mutation Average:71.036; most accessible tissue: Callus, score: 84.299 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0824413447 NA 2.11E-09 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824413447 NA 6.10E-09 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824413447 NA 9.71E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824413447 NA 4.34E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824413447 1.25E-06 9.56E-08 mr1955 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824413447 NA 7.64E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824413447 NA 8.85E-13 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824413447 NA 3.23E-07 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824413447 NA 1.13E-09 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824413447 NA 5.05E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251