| Variant ID: vg0824365210 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 24365210 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTCGTCTTATTAAAAAAATTTAAGTAATTGTTAATTCTTTTTCTATCATTTGATTCATTGTTAAATATACTTTTATGTATACATATAGTTTTACATATTT[C/T]
ACAAAAGTTTTTGAATAAGATGAATGATCAAACATGTTTAAAAAATTCAACGGCGTTAAACATTTAGAAAAGGAGAGAGAGTACTAATTAACATAGTCGA
TCGACTATGTTAATTAGTACTCTCTCTCCTTTTCTAAATGTTTAACGCCGTTGAATTTTTTAAACATGTTTGATCATTCATCTTATTCAAAAACTTTTGT[G/A]
AAATATGTAAAACTATATGTATACATAAAAGTATATTTAACAATGAATCAAATGATAGAAAAAGAATTAACAATTACTTAAATTTTTTTAATAAGACGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.70% | 17.80% | 2.52% | 0.00% | NA |
| All Indica | 2759 | 95.60% | 3.80% | 0.62% | 0.00% | NA |
| All Japonica | 1512 | 62.70% | 31.30% | 5.95% | 0.00% | NA |
| Aus | 269 | 12.30% | 85.10% | 2.60% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 93.10% | 5.60% | 1.29% | 0.00% | NA |
| Indica III | 913 | 95.50% | 4.20% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 94.00% | 5.10% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 80.80% | 11.70% | 7.43% | 0.00% | NA |
| Tropical Japonica | 504 | 30.40% | 65.10% | 4.56% | 0.00% | NA |
| Japonica Intermediate | 241 | 72.60% | 23.20% | 4.15% | 0.00% | NA |
| VI/Aromatic | 96 | 81.20% | 16.70% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 16.70% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0824365210 | C -> T | LOC_Os08g38520.1 | upstream_gene_variant ; 762.0bp to feature; MODIFIER | silent_mutation | Average:55.027; most accessible tissue: Callus, score: 82.896 | N | N | N | N |
| vg0824365210 | C -> T | LOC_Os08g38510.1 | downstream_gene_variant ; 400.0bp to feature; MODIFIER | silent_mutation | Average:55.027; most accessible tissue: Callus, score: 82.896 | N | N | N | N |
| vg0824365210 | C -> T | LOC_Os08g38530.1 | downstream_gene_variant ; 2321.0bp to feature; MODIFIER | silent_mutation | Average:55.027; most accessible tissue: Callus, score: 82.896 | N | N | N | N |
| vg0824365210 | C -> T | LOC_Os08g38510-LOC_Os08g38520 | intergenic_region ; MODIFIER | silent_mutation | Average:55.027; most accessible tissue: Callus, score: 82.896 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0824365210 | NA | 8.83E-06 | mr1042 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824365210 | NA | 8.07E-10 | mr1578 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824365210 | NA | 1.62E-11 | mr1696 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824365210 | NA | 1.00E-06 | mr1742 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824365210 | 5.58E-06 | 5.58E-06 | mr1975 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |