\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0824309188:

Variant ID: vg0824309188 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 24309188
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCTTTATTAATATATCATGATATATTTTTGTCTATTTTATTATCTATAATTGCATTGTTATATATTAGCGTCGTTACATTTACAGCGTTTATAAAATTG[T/A]
TGCGTGAGTCGGACCGCCCATACGCTAAATCCTACATACGCCACTGGACTCGTCGCCGCTTGGCTGCCCCGTCATCCTGCCCTACACTCGCGAGAGATGA

Reverse complement sequence

TCATCTCTCGCGAGTGTAGGGCAGGATGACGGGGCAGCCAAGCGGCGACGAGTCCAGTGGCGTATGTAGGATTTAGCGTATGGGCGGTCCGACTCACGCA[A/T]
CAATTTTATAAACGCTGTAAATGTAACGACGCTAATATATAACAATGCAATTATAGATAATAAAATAGACAAAAATATATCATGATATATTAATAAAGCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.50% 2.20% 0.21% 0.00% NA
All Indica  2759 95.80% 3.80% 0.33% 0.00% NA
All Japonica  1512 99.90% 0.00% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.10% 4.00% 0.84% 0.00% NA
Indica II  465 98.10% 1.50% 0.43% 0.00% NA
Indica III  913 95.50% 4.50% 0.00% 0.00% NA
Indica Intermediate  786 95.40% 4.30% 0.25% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0824309188 T -> A LOC_Os08g38400.1 upstream_gene_variant ; 1852.0bp to feature; MODIFIER silent_mutation Average:54.157; most accessible tissue: Callus, score: 86.758 N N N N
vg0824309188 T -> A LOC_Os08g38410.1 downstream_gene_variant ; 4157.0bp to feature; MODIFIER silent_mutation Average:54.157; most accessible tissue: Callus, score: 86.758 N N N N
vg0824309188 T -> A LOC_Os08g38410.2 downstream_gene_variant ; 4157.0bp to feature; MODIFIER silent_mutation Average:54.157; most accessible tissue: Callus, score: 86.758 N N N N
vg0824309188 T -> A LOC_Os08g38380-LOC_Os08g38400 intergenic_region ; MODIFIER silent_mutation Average:54.157; most accessible tissue: Callus, score: 86.758 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0824309188 NA 2.11E-06 mr1008 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824309188 3.74E-07 3.74E-07 mr1027 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824309188 NA 3.85E-06 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824309188 NA 5.71E-06 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251