\
| Variant ID: vg0824309188 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 24309188 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGCTTTATTAATATATCATGATATATTTTTGTCTATTTTATTATCTATAATTGCATTGTTATATATTAGCGTCGTTACATTTACAGCGTTTATAAAATTG[T/A]
TGCGTGAGTCGGACCGCCCATACGCTAAATCCTACATACGCCACTGGACTCGTCGCCGCTTGGCTGCCCCGTCATCCTGCCCTACACTCGCGAGAGATGA
TCATCTCTCGCGAGTGTAGGGCAGGATGACGGGGCAGCCAAGCGGCGACGAGTCCAGTGGCGTATGTAGGATTTAGCGTATGGGCGGTCCGACTCACGCA[A/T]
CAATTTTATAAACGCTGTAAATGTAACGACGCTAATATATAACAATGCAATTATAGATAATAAAATAGACAAAAATATATCATGATATATTAATAAAGCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.50% | 2.20% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 95.80% | 3.80% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.10% | 4.00% | 0.84% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.50% | 0.43% | 0.00% | NA |
| Indica III | 913 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.40% | 4.30% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0824309188 | T -> A | LOC_Os08g38400.1 | upstream_gene_variant ; 1852.0bp to feature; MODIFIER | silent_mutation | Average:54.157; most accessible tissue: Callus, score: 86.758 | N | N | N | N |
| vg0824309188 | T -> A | LOC_Os08g38410.1 | downstream_gene_variant ; 4157.0bp to feature; MODIFIER | silent_mutation | Average:54.157; most accessible tissue: Callus, score: 86.758 | N | N | N | N |
| vg0824309188 | T -> A | LOC_Os08g38410.2 | downstream_gene_variant ; 4157.0bp to feature; MODIFIER | silent_mutation | Average:54.157; most accessible tissue: Callus, score: 86.758 | N | N | N | N |
| vg0824309188 | T -> A | LOC_Os08g38380-LOC_Os08g38400 | intergenic_region ; MODIFIER | silent_mutation | Average:54.157; most accessible tissue: Callus, score: 86.758 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0824309188 | NA | 2.11E-06 | mr1008 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824309188 | 3.74E-07 | 3.74E-07 | mr1027 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824309188 | NA | 3.85E-06 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824309188 | NA | 5.71E-06 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |