\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0824284842:

Variant ID: vg0824284842 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 24284842
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACTAGCGAATACTCACGGAGCAATCGTACGGCCAGCGACACCGACTAAAATCAGCCCAAAAAACTGGCGACATATTTTTAGCAATTCCGTAAGATAATG[C/G]
CTCAAGTTATTTTTTAAAAAGCATATTGTAATATAATAATAGTAGTGCAATTTAATGTAACTACTATAACTACGTTCTAACTTTTATATAATAACTTATA

Reverse complement sequence

TATAAGTTATTATATAAAAGTTAGAACGTAGTTATAGTAGTTACATTAAATTGCACTACTATTATTATATTACAATATGCTTTTTAAAAAATAACTTGAG[G/C]
CATTATCTTACGGAATTGCTAAAAATATGTCGCCAGTTTTTTGGGCTGATTTTAGTCGGTGTCGCTGGCCGTACGATTGCTCCGTGAGTATTCGCTAGTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.70% 12.40% 1.90% 0.00% NA
All Indica  2759 98.50% 1.30% 0.18% 0.00% NA
All Japonica  1512 64.90% 30.00% 5.16% 0.00% NA
Aus  269 68.00% 30.50% 1.49% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 98.80% 1.20% 0.00% 0.00% NA
Indica Intermediate  786 96.70% 2.70% 0.64% 0.00% NA
Temperate Japonica  767 76.10% 15.80% 8.08% 0.00% NA
Tropical Japonica  504 44.80% 52.60% 2.58% 0.00% NA
Japonica Intermediate  241 71.00% 27.80% 1.24% 0.00% NA
VI/Aromatic  96 89.60% 8.30% 2.08% 0.00% NA
Intermediate  90 91.10% 7.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0824284842 C -> G LOC_Os08g38330.1 upstream_gene_variant ; 4173.0bp to feature; MODIFIER silent_mutation Average:27.201; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0824284842 C -> G LOC_Os08g38340.1 downstream_gene_variant ; 465.0bp to feature; MODIFIER silent_mutation Average:27.201; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0824284842 C -> G LOC_Os08g38350.1 downstream_gene_variant ; 695.0bp to feature; MODIFIER silent_mutation Average:27.201; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0824284842 C -> G LOC_Os08g38360.1 downstream_gene_variant ; 3310.0bp to feature; MODIFIER silent_mutation Average:27.201; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0824284842 C -> G LOC_Os08g38340-LOC_Os08g38350 intergenic_region ; MODIFIER silent_mutation Average:27.201; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0824284842 NA 2.59E-09 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824284842 3.72E-06 8.49E-07 mr1406_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824284842 NA 2.59E-08 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824284842 NA 4.33E-08 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251