\
| Variant ID: vg0824284842 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 24284842 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GACTAGCGAATACTCACGGAGCAATCGTACGGCCAGCGACACCGACTAAAATCAGCCCAAAAAACTGGCGACATATTTTTAGCAATTCCGTAAGATAATG[C/G]
CTCAAGTTATTTTTTAAAAAGCATATTGTAATATAATAATAGTAGTGCAATTTAATGTAACTACTATAACTACGTTCTAACTTTTATATAATAACTTATA
TATAAGTTATTATATAAAAGTTAGAACGTAGTTATAGTAGTTACATTAAATTGCACTACTATTATTATATTACAATATGCTTTTTAAAAAATAACTTGAG[G/C]
CATTATCTTACGGAATTGCTAAAAATATGTCGCCAGTTTTTTGGGCTGATTTTAGTCGGTGTCGCTGGCCGTACGATTGCTCCGTGAGTATTCGCTAGTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.70% | 12.40% | 1.90% | 0.00% | NA |
| All Indica | 2759 | 98.50% | 1.30% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 64.90% | 30.00% | 5.16% | 0.00% | NA |
| Aus | 269 | 68.00% | 30.50% | 1.49% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.70% | 2.70% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 76.10% | 15.80% | 8.08% | 0.00% | NA |
| Tropical Japonica | 504 | 44.80% | 52.60% | 2.58% | 0.00% | NA |
| Japonica Intermediate | 241 | 71.00% | 27.80% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 8.30% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 7.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0824284842 | C -> G | LOC_Os08g38330.1 | upstream_gene_variant ; 4173.0bp to feature; MODIFIER | silent_mutation | Average:27.201; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0824284842 | C -> G | LOC_Os08g38340.1 | downstream_gene_variant ; 465.0bp to feature; MODIFIER | silent_mutation | Average:27.201; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0824284842 | C -> G | LOC_Os08g38350.1 | downstream_gene_variant ; 695.0bp to feature; MODIFIER | silent_mutation | Average:27.201; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0824284842 | C -> G | LOC_Os08g38360.1 | downstream_gene_variant ; 3310.0bp to feature; MODIFIER | silent_mutation | Average:27.201; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0824284842 | C -> G | LOC_Os08g38340-LOC_Os08g38350 | intergenic_region ; MODIFIER | silent_mutation | Average:27.201; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0824284842 | NA | 2.59E-09 | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824284842 | 3.72E-06 | 8.49E-07 | mr1406_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824284842 | NA | 2.59E-08 | mr1449_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824284842 | NA | 4.33E-08 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |