\
| Variant ID: vg0824279038 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 24279038 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTTTTTTTTAAGTAACTTTCATATAGAAACTTTTTACGAAAAACGCACCGTTTAGCAGTTTGAAAAGCGTGCGCGCGGAATACAACGAAGAGGGGTTGGT[G/A]
ACTCAGGATTGCAAACACAGTAAAAGGGATCAGTAAAACTGATCTAAATCCGCGATACCGTGGTGCAACTCGCTGGGGAGCTTCCGCATGACGCCGACCA
TGGTCGGCGTCATGCGGAAGCTCCCCAGCGAGTTGCACCACGGTATCGCGGATTTAGATCAGTTTTACTGATCCCTTTTACTGTGTTTGCAATCCTGAGT[C/T]
ACCAACCCCTCTTCGTTGTATTCCGCGCGCACGCTTTTCAAACTGCTAAACGGTGCGTTTTTCGTAAAAAGTTTCTATATGAAAGTTACTTAAAAAAAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.20% | 19.10% | 0.68% | 0.00% | NA |
| All Indica | 2759 | 91.90% | 8.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 69.90% | 28.20% | 1.92% | 0.00% | NA |
| Aus | 269 | 40.10% | 59.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 79.60% | 20.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.70% | 5.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 89.80% | 10.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 93.20% | 4.20% | 2.61% | 0.00% | NA |
| Tropical Japonica | 504 | 39.90% | 58.90% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 58.50% | 40.20% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 15.60% | 81.20% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0824279038 | G -> A | LOC_Os08g38340.1 | upstream_gene_variant ; 3822.0bp to feature; MODIFIER | silent_mutation | Average:58.55; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0824279038 | G -> A | LOC_Os08g38320.1 | downstream_gene_variant ; 1522.0bp to feature; MODIFIER | silent_mutation | Average:58.55; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0824279038 | G -> A | LOC_Os08g38330.1 | downstream_gene_variant ; 30.0bp to feature; MODIFIER | silent_mutation | Average:58.55; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0824279038 | G -> A | LOC_Os08g38320.3 | downstream_gene_variant ; 1522.0bp to feature; MODIFIER | silent_mutation | Average:58.55; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0824279038 | G -> A | LOC_Os08g38320.2 | downstream_gene_variant ; 1522.0bp to feature; MODIFIER | silent_mutation | Average:58.55; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0824279038 | G -> A | LOC_Os08g38320-LOC_Os08g38330 | intergenic_region ; MODIFIER | silent_mutation | Average:58.55; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0824279038 | NA | 6.27E-06 | mr1087 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824279038 | NA | 8.91E-06 | mr1094 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824279038 | NA | 9.58E-09 | mr1557 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824279038 | NA | 8.50E-09 | mr1570 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824279038 | NA | 2.08E-08 | mr1593 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824279038 | NA | 1.09E-08 | mr1769 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824279038 | NA | 3.35E-06 | mr1958 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824279038 | NA | 3.11E-06 | mr1091_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824279038 | NA | 2.39E-06 | mr1188_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824279038 | NA | 2.85E-07 | mr1321_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824279038 | 8.20E-06 | NA | mr1334_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824279038 | NA | 3.18E-06 | mr1416_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824279038 | NA | 7.41E-14 | mr1593_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824279038 | NA | 2.75E-08 | mr1769_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824279038 | 9.04E-06 | NA | mr1991_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824279038 | 2.82E-06 | 5.05E-10 | mr1991_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |