\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0824279038:

Variant ID: vg0824279038 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 24279038
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTTTTTTAAGTAACTTTCATATAGAAACTTTTTACGAAAAACGCACCGTTTAGCAGTTTGAAAAGCGTGCGCGCGGAATACAACGAAGAGGGGTTGGT[G/A]
ACTCAGGATTGCAAACACAGTAAAAGGGATCAGTAAAACTGATCTAAATCCGCGATACCGTGGTGCAACTCGCTGGGGAGCTTCCGCATGACGCCGACCA

Reverse complement sequence

TGGTCGGCGTCATGCGGAAGCTCCCCAGCGAGTTGCACCACGGTATCGCGGATTTAGATCAGTTTTACTGATCCCTTTTACTGTGTTTGCAATCCTGAGT[C/T]
ACCAACCCCTCTTCGTTGTATTCCGCGCGCACGCTTTTCAAACTGCTAAACGGTGCGTTTTTCGTAAAAAGTTTCTATATGAAAGTTACTTAAAAAAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.20% 19.10% 0.68% 0.00% NA
All Indica  2759 91.90% 8.10% 0.00% 0.00% NA
All Japonica  1512 69.90% 28.20% 1.92% 0.00% NA
Aus  269 40.10% 59.90% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 79.60% 20.40% 0.00% 0.00% NA
Indica III  913 94.70% 5.30% 0.00% 0.00% NA
Indica Intermediate  786 89.80% 10.20% 0.00% 0.00% NA
Temperate Japonica  767 93.20% 4.20% 2.61% 0.00% NA
Tropical Japonica  504 39.90% 58.90% 1.19% 0.00% NA
Japonica Intermediate  241 58.50% 40.20% 1.24% 0.00% NA
VI/Aromatic  96 15.60% 81.20% 3.12% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0824279038 G -> A LOC_Os08g38340.1 upstream_gene_variant ; 3822.0bp to feature; MODIFIER silent_mutation Average:58.55; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0824279038 G -> A LOC_Os08g38320.1 downstream_gene_variant ; 1522.0bp to feature; MODIFIER silent_mutation Average:58.55; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0824279038 G -> A LOC_Os08g38330.1 downstream_gene_variant ; 30.0bp to feature; MODIFIER silent_mutation Average:58.55; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0824279038 G -> A LOC_Os08g38320.3 downstream_gene_variant ; 1522.0bp to feature; MODIFIER silent_mutation Average:58.55; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0824279038 G -> A LOC_Os08g38320.2 downstream_gene_variant ; 1522.0bp to feature; MODIFIER silent_mutation Average:58.55; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0824279038 G -> A LOC_Os08g38320-LOC_Os08g38330 intergenic_region ; MODIFIER silent_mutation Average:58.55; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0824279038 NA 6.27E-06 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824279038 NA 8.91E-06 mr1094 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824279038 NA 9.58E-09 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824279038 NA 8.50E-09 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824279038 NA 2.08E-08 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824279038 NA 1.09E-08 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824279038 NA 3.35E-06 mr1958 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824279038 NA 3.11E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824279038 NA 2.39E-06 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824279038 NA 2.85E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824279038 8.20E-06 NA mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824279038 NA 3.18E-06 mr1416_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824279038 NA 7.41E-14 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824279038 NA 2.75E-08 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824279038 9.04E-06 NA mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824279038 2.82E-06 5.05E-10 mr1991_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251