Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0824279038:

Variant ID: vg0824279038 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 24279038
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTTTTTTTAAGTAACTTTCATATAGAAACTTTTTACGAAAAACGCACCGTTTAGCAGTTTGAAAAGCGTGCGCGCGGAATACAACGAAGAGGGGTTGGT[G/A]
ACTCAGGATTGCAAACACAGTAAAAGGGATCAGTAAAACTGATCTAAATCCGCGATACCGTGGTGCAACTCGCTGGGGAGCTTCCGCATGACGCCGACCA

Reverse complement sequence

TGGTCGGCGTCATGCGGAAGCTCCCCAGCGAGTTGCACCACGGTATCGCGGATTTAGATCAGTTTTACTGATCCCTTTTACTGTGTTTGCAATCCTGAGT[C/T]
ACCAACCCCTCTTCGTTGTATTCCGCGCGCACGCTTTTCAAACTGCTAAACGGTGCGTTTTTCGTAAAAAGTTTCTATATGAAAGTTACTTAAAAAAAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.20%	19.10%	0.68%	0.00%	NA
All Indica	2759	91.90%	8.10%	0.00%	0.00%	NA
All Japonica	1512	69.90%	28.20%	1.92%	0.00%	NA
Aus	269	40.10%	59.90%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	79.60%	20.40%	0.00%	0.00%	NA
Indica III	913	94.70%	5.30%	0.00%	0.00%	NA
Indica Intermediate	786	89.80%	10.20%	0.00%	0.00%	NA
Temperate Japonica	767	93.20%	4.20%	2.61%	0.00%	NA
Tropical Japonica	504	39.90%	58.90%	1.19%	0.00%	NA
Japonica Intermediate	241	58.50%	40.20%	1.24%	0.00%	NA
VI/Aromatic	96	15.60%	81.20%	3.12%	0.00%	NA
Intermediate	90	83.30%	16.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0824279038	G -> A	LOC_Os08g38340.1	upstream_gene_variant ; 3822.0bp to feature; MODIFIER	silent_mutation	Average:58.55; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0824279038	G -> A	LOC_Os08g38320.1	downstream_gene_variant ; 1522.0bp to feature; MODIFIER	silent_mutation	Average:58.55; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0824279038	G -> A	LOC_Os08g38330.1	downstream_gene_variant ; 30.0bp to feature; MODIFIER	silent_mutation	Average:58.55; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0824279038	G -> A	LOC_Os08g38320.3	downstream_gene_variant ; 1522.0bp to feature; MODIFIER	silent_mutation	Average:58.55; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0824279038	G -> A	LOC_Os08g38320.2	downstream_gene_variant ; 1522.0bp to feature; MODIFIER	silent_mutation	Average:58.55; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0824279038	G -> A	LOC_Os08g38320-LOC_Os08g38330	intergenic_region ; MODIFIER	silent_mutation	Average:58.55; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0824279038	NA	6.27E-06	mr1087	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824279038	NA	8.91E-06	mr1094	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824279038	NA	9.58E-09	mr1557	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824279038	NA	8.50E-09	mr1570	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824279038	NA	2.08E-08	mr1593	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824279038	NA	1.09E-08	mr1769	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824279038	NA	3.35E-06	mr1958	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824279038	NA	3.11E-06	mr1091_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824279038	NA	2.39E-06	mr1188_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824279038	NA	2.85E-07	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824279038	8.20E-06	NA	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824279038	NA	3.18E-06	mr1416_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824279038	NA	7.41E-14	mr1593_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824279038	NA	2.75E-08	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824279038	9.04E-06	NA	mr1991_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824279038	2.82E-06	5.05E-10	mr1991_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251