Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0824162398:

Variant ID: vg0824162398 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 24162398
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAAGATCATGTAGAGAGAACTCAACTAATAACTTATATATTACTTGTGATAATCATATTCTAAGCAGGGGTTAAGATAATCCAAGGGTACAGTGACACAC[A/G]
AGCATTACTACTCATCCTCGTAATAATTAATCTAAGCTAGGTAGAAAGAAAAGAGAAAGAGAATCTATTCCTATACTTCTAATATACATAGTATACATAC

Reverse complement sequence

GTATGTATACTATGTATATTAGAAGTATAGGAATAGATTCTCTTTCTCTTTTCTTTCTACCTAGCTTAGATTAATTATTACGAGGATGAGTAGTAATGCT[T/C]
GTGTGTCACTGTACCCTTGGATTATCTTAACCCCTGCTTAGAATATGATTATCACAAGTAATATATAAGTTATTAGTTGAGTTCTCTCTACATGATCTTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.50%	2.90%	1.57%	6.03%	NA
All Indica	2759	88.10%	5.00%	1.52%	5.36%	NA
All Japonica	1512	99.90%	0.00%	0.00%	0.13%	NA
Aus	269	40.50%	0.00%	11.15%	48.33%	NA
Indica I	595	80.20%	16.60%	3.19%	0.00%	NA
Indica II	465	79.40%	3.70%	1.51%	15.48%	NA
Indica III	913	96.50%	0.00%	0.22%	3.29%	NA
Indica Intermediate	786	89.70%	2.70%	1.78%	5.85%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	95.80%	0.00%	0.00%	4.17%	NA
Intermediate	90	96.70%	0.00%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0824162398	A -> G	LOC_Os08g38130.1	upstream_gene_variant ; 2546.0bp to feature; MODIFIER	silent_mutation	Average:43.638; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N
vg0824162398	A -> G	LOC_Os08g38120.1	downstream_gene_variant ; 4849.0bp to feature; MODIFIER	silent_mutation	Average:43.638; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N
vg0824162398	A -> G	LOC_Os08g38140.1	downstream_gene_variant ; 842.0bp to feature; MODIFIER	silent_mutation	Average:43.638; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N
vg0824162398	A -> G	LOC_Os08g38150.1	intron_variant ; MODIFIER	silent_mutation	Average:43.638; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N
vg0824162398	A -> DEL	N	N	silent_mutation	Average:43.638; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0824162398	NA	4.89E-06	mr1008	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824162398	NA	1.31E-06	mr1009	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824162398	NA	5.78E-08	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824162398	NA	8.18E-08	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824162398	NA	7.75E-09	mr1389	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824162398	NA	1.08E-07	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824162398	NA	6.66E-10	mr1038_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824162398	NA	6.46E-09	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824162398	NA	1.92E-11	mr1389_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824162398	NA	2.34E-10	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824162398	9.77E-06	NA	mr1544_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824162398	NA	8.90E-06	mr1571_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824162398	2.18E-06	1.18E-06	mr1932_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251